Category: Plant

The study of organelle DNA variability in alloplasmic barley lines in the NGS era

The study of organelle DNA variability in alloplasmic barley lines in the NGS era

Alloplasmic strains are an acceptable mannequin for finding out molecular coevolution and interrelations between genetic programs of plant cells. Complete chloroplast (cp) and mitochondrial (mt) genome sequences had been obtained by the MiSeq System (Illumina). Organelle DNA samples had been ready from a set of 12 alloplasmic barley strains with completely different cytoplasms of Hordeum vulgare ssp. spontaneum and H. vulgare ssp. vulgare, in addition to from their paternal varieties. A bioinformatic strategy for evaluation of NGS information obtained on an organellar DNA combine has been developed and verified.

A comparative research of Hordeum organelle genomes’ variability and disposition of polymorphic loci was performed. Eight forms of chloroplast DNA and 5 forms of mitochondrial DNA had been distinguished for the barley pattern set examined. These outcomes had been in contrast with the earlier information of a restriction fragment size polymorphism (RFLP) research of organelle DNAs for a similar materials. Previously established information a few discipline analysis of alloplasmic barley strains had been revised within the gentle of details about organelle genomes gained after NGS. Completely 17 polymorphic loci had been discovered at exons of chloroplast genomes.

Seven of the SNPs had been situated within the genes of the Ndh complicated. The nonsynonymous adjustments of nucleotides had been detected within the matK, rpoC1, ndhK, ndhG and infA genes. A few of the SNPs detected are very comparable in codon place and in the kind of amino acid substitution to the locations the place RNA modifying can happen. Thus, these outcomes define new views for the long run research of nuclear-cytoplasmic interactions in alloplasmic strains. Roughly 10%, 27%, and 63% of the 540 samples contained < 1500 GE, a variety of 1500-3000 GE, and > 3000 GE, which corresponded to a maximal assay sensitivity of two.0%, 0.5-0.1%, and 0.1-0.05% mutant allelic fraction, respectively.

The sensitivity and specificity had been measured for this BEAMing assay. The variety of mutant beads and mutant allelic fraction had been measured for every EGFR alteration and the extent of detection was established at 0.1% for a median of 2861 genome equal (GE) in every response utilizing HD780 horizon management DNA, in addition to by an inner high quality reference commonplace.  In a routine hospital setting, 11.4% of non-small cell lung most cancers tumors had been constructive at prognosis for EGFR alterations, whereas 43.7% samples harbored EGFR mutations at development, amongst which 40.3% expressed EGFR resistance mutations after first-line tyrosine kinase inhibitor remedy with first- and second-generation medication.

Molecular subtype prognosis of endometrial carcinoma: comparability of NGS panel and ProMisE classifier

The Most cancers Genome Atlas-based molecular classification of endometrial carcinoma (EC) has the potential to higher determine these sufferers whose illness is prone to behave in another way than predicted when utilizing conventional threat stratification, nonetheless, the optimum strategy to molecular subtype task in routine observe stays undetermined. The goal of this research was to check the outcomes of two completely different broadly obtainable approaches to prognosis of EC molecular subtype.
 EC from 60 sufferers, had been molecularly subclassified utilizing two completely different strategies; by performing the FoundationOne CDx Subsequent Technology Sequencing (NGS) panel and utilizing the Proactive Molecular Threat Classifier for Endometrial Most cancers (ProMisE) classifier and performing immunohistochemical stainings for MMR proteins and p53. MSI standing may very well be decided based mostly on the NGS panel ends in 53 of 60 tumors, so ProMisE and NGS molecular subtype task may very well be straight in contrast for these 53 tumors. Molecular subtype prognosis based mostly on NGS and ProMisE was in settlement for 52 of 53 tumors. One tumor was microsatellite steady (MSS) however confirmed lack of MLH1 and PMS2 expression.
 Molecular subtype prognosis of EC based mostly on NGS panel sequencing of formalin-fixed paraffin-embedded endometrial carcinomas and based mostly totally on immunostaining (ProMisE) yield equivalent ends in 98.1% (52/53, kappa – 0.97) of circumstances. Whereas outcomes are comparable utilizing these two approaches, every has benefits and drawbacks that may affect the selection of methodology for use in scientific observe. POLE mutation standing was in each settings derived from FoundationOne outcomes. Molecular classification based mostly on ProMisE was profitable for all 60 tumors.
The study of organelle DNA variability in alloplasmic barley lines in the NGS era

[NGS sequencing in barley breeding and genetic studies]

Barley (Hordeum vulgare L.) is the some of the necessary cereal species used as meals and feed crops, in addition to for malting and alcohol manufacturing. On the finish of the final century, conventional breeding methods had been complemented by means of DNA markers. Molecular markers have additionally been used extensively for molecular genetic mapping and QTL evaluation. In 2012, the barley genome sequencing was accomplished, which supplied a broad vary of recent alternatives – from a extra environment friendly seek for candidate genes controlling economically necessary traits to genomic choice.

The evaluation summarizes the outcomes of the research carried out after barley genome sequencing, which found new areas of barley genetics and breeding with excessive throughput screening and genotyping strategies. Throughout this era, intensive research geared toward identification of barley genomic loci related to economically necessary traits have been carried out; on-line databases and instruments for working with barley genomic information and their deposition have appeared and are being replenished. Lately, GWAS evaluation has been used for large-scale phenotypegenotype affiliation research, which has been broadly utilized in barley since 2010 because of the developed SNP-arrays, in addition to genotyping strategies based mostly on direct NGS sequencing of chosen fractions of the genome.

uv transilluminator 20x20cm, 312nm, 50/100% switch

UVTR2200 ea
EUR 1161

BLook: LED Transilluminator

BK001 1 pcs Ask for price

nUVaClean UV pipette carousel, with UV lamp, for 6 universal pipettes,

P5590 1/pack
EUR 356.25
Description: nUVaClean UV pipette carousel with UV lamp

nUVaClean UV pipette carousel, with UV lamp, for 6 universal pipettes,

P5590-E 1/pack
EUR 356.25
Description: nUVaClean UV pipette carousel with UV lamp

Standard UV Quartz Cell with Teflon Stopper

SQ014 1 UNIT
EUR 147.24
  • Product category: Labware/Cuvettes/Quartz Cells

transilluminator led 20x12 cm + hood

BLOOK ea
EUR 580

Semi-Micro UV Quartz Cell With Frosted Walls and with Teflon Stopper

SQ294 1 UNIT
EUR 171.19
  • Product category: Labware/Cuvettes/Quartz Cells

Micro UV Quartz Cell With Lid, Inside Width: 2mm, 0.7ml

SQ244 1 UNIT
EUR 123.3
  • Product category: Labware/Cuvettes/Quartz Cells

Micro UV Quartz Cell With Lid, Inside Width: 4mm, 1.4ml

SQ264 1 UNIT
EUR 123.3
  • Product category: Labware/Cuvettes/Quartz Cells

Micro UV Quartz Cell With Lid, Inside Width: 5mm, 1.7ml

SQ274 1 UNIT
EUR 123.3
  • Product category: Labware/Cuvettes/Quartz Cells

Fluorescent UV Particles

FP-15040-2 2 mL
EUR 283
Description: Please reffer to the technical data sheet for more detail information for this item. Our dedicated team would be happy to assist you via live chat, email or phone.

UV TRANSMITTING TRAY

GD-GCS 1/pk
EUR 208
Description: Lab Equipment; Axygen Branded EQ

uv protected glasses

VLLP70 ea
EUR 99

Semi-Micro UV Glass Cell With Black Walls And With Lid, Inside Width: 4mm, 1.4ml

S024-G 1 UNIT
EUR 104.15
  • Product category: Labware/Cuvettes/Glass Cells

Semi-Micro UV Glass Cell With Black Walls And With Lid, Inside Width: 5mm, 1.7ml

S144-G 1 UNIT
EUR 104.15
  • Product category: Labware/Cuvettes/Glass Cells

Semi-Micro UV Quartz Cell With Black Walls And With Lid, Inside Width: 4mm, 1.4ml

SQ024 1 UNIT
EUR 123.3
  • Product category: Labware/Cuvettes/Quartz Cells

Semi-Micro UV Quartz Cell With Black Walls And With Lid, Inside Width: 5mm, 1.7ml

SQ144 1 UNIT
EUR 123.3
  • Product category: Labware/Cuvettes/Quartz Cells

SmartDoc UV Blocking Mat

E5000-MAT 1 PC
EUR 100.67
  • To order instruments in 115V / US plug please delete the 'E' off the order code.European 2 pin plugs will be supplied as standard, please request UK if required.

uv lamp 1x15w, 254nm

VL115-C ea
EUR 656

uv lamp 1x15w, 365nm

VL115-L ea
EUR 656

uv lamp 1x15w, 312nm

VL115-M ea
EUR 656

uv lamp 2x15w, 254nm

VL215-C ea
EUR 792

uv lamp 2x15w, 365nm

VL215-L ea
EUR 792

uv lamp 2x15w, 312nm

VL215-M ea
EUR 817

uv lamp 1x6w, 254nm

VL6-C ea
EUR 521

uv lamp 1x6w, 365nm

VL6-L ea
EUR 521

conversion screen uv/blue

VLFC26-BLUE ea
EUR 606

conversion screen uv/wl

VLFC26-WL ea
EUR 606

uv protected face shield

VLMP80 ea
EUR 183

uv protected face shield

VLMP800 ea
EUR 200

UV Carboxyl Particle Array Kit

UVCPAK--5042-14K 14X1 mL
EUR 1278
Description: UltraRainbow Fluorescent Particlesare calibration particles that help you to determine if a flow cytometer is properly aligned and has a clean flow cell with no fluidic blockage. Using SPHERO? Alignment Particles, the coefficients of variation (CVs), peak channels, and histogram distributions can be measured to determine the alignment and functionality of the flow cytometer.

uv lamp 2x15w, 254/365nm

VL215-LC ea
EUR 817

uv lamp 2x15w, 312/365nm

VL215-LM ea
EUR 817

uv lamp 2x15w, 254/312nm

VL215-MC ea
EUR 859

uv lamp 2x6w, 254/365nm

VL6-LC ea
EUR 538

starter uv tube 4w-20w

VLST151 ea
EUR 56

uv table 8w 254nm 15x15 cm

VLECX-15C ea
EUR 1028

uv table 8w 312nm 15x15 cm

VLECX-15M ea
EUR 1028

uv table blue led 20x20 cm

VLECX-20BLUE ea
EUR 1535

uv table 8w 254nm 20x20 cm

VLECX-20C ea
EUR 1113

uv table 8w 365nm 20x20 cm

VLECX-20L ea
EUR 1113

uv table 8w 312nm 20x20 cm

VLECX-20M ea
EUR 1163

uv table 8w, 254nm 21x26 cm

VLECX-26C ea
EUR 1197

uv table 8w, 312nm 21x26 cm

VLECX-26M ea
EUR 1248

uv tube 15 w, 254 nm

VLT15-C ea
EUR 56

uv tube 15 w, 365 nm

VLT15-L ea
EUR 56

uv tube 15 w, 312 nm

VLT15-M ea
EUR 82

uv tube 4 w, 254 nm

VLT4-C ea
EUR 56

uv tube 4 w, 365 nm

VLT4-L ea
EUR 56

uv tube 6 w, 254 nm

VLT6-C ea
EUR 56

uv tube 6 w, 365 nm

VLT6-L ea
EUR 56

uv tube 8 w, 254 nm

VLT8-C ea
EUR 56

uv tube 8 w, 365 nm

VLT8-L ea
EUR 56

uv tube 8 w, 312 nm

VLT8-M ea
EUR 82

Absolute Mag Magnetic Particles, Fluorescent UV

WHM-S135 2 mL
EUR 604

Standard UV Quartz Cell With Lid, 45 X 12.5 X 7.5 mm, Inside Width: 10mm, 1.7ml

SQ003 1 UNIT
EUR 93.5
  • Product category: Labware/Cuvettes/Quartz Cells

Standard UV Quartz Cell With Lid, 45 X 12.5 X 12.5 mm, Inside Width: 10mm, 3.5ml

SQ004 1 UNIT
EUR 100.46
  • Product category: Labware/Cuvettes/Quartz Cells

Standard UV Quartz Cell With Lid, 45 X 12.5 X 22.5 mm, Inside Width: 10mm, 7.0ml

SQ005 1 UNIT
EUR 128.09
  • Product category: Labware/Cuvettes/Quartz Cells

AXYGEN® GEL TRAY 10 X 10 CM FOR USE WITH 10 CM GEL BOX, UV TRANSPARENT

HGB10-10-GT 1/pk
EUR 74
Description: Lab Equipment; Axygen Branded EQ

AXYGEN® GEL TRAY 15 X 10 CM FOR USE WITH 15 CM GEL BOX, UV TRANSPARENT

HGB15-10-GT 1/pk
EUR 79
Description: Lab Equipment; Axygen Branded EQ

AXYGEN® GEL TRAY 15 X 15 CM FOR USE WITH 15 CM GEL BOX, UV TRANSPARENT

HGB15-15-GT 1/pk
EUR 79
Description: Lab Equipment; Axygen Branded EQ

AXYGEN® GEL TRAY 20 X 20 CM FOR USE WITH 20 CM GEL BOX, UV TRANSPARENT

HGB20-20-GT 1/pk
EUR 97
Description: Lab Equipment; Axygen Branded EQ

AXYGEN® GEL TRAY 7 X 10 CM FOR USE WITH 7 CM GEL BOX, UV TRANSPARENT

HGB7-10-GT 1/pk
EUR 68
Description: Lab Equipment; Axygen Branded EQ

AXYGEN® GEL TRAY 7 X 7 CM FOR USE WITH 7 CM GEL BOX, UV TRANSPARENT

HGB7-7-GT 1/pk
EUR 61
Description: Lab Equipment; Axygen Branded EQ

Uv Radiation Resistance Associated Gene (UVRAG) Antibody

20-abx116558
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

PLT,96WL,UV,NT,NS,25/50

3635 25/pk
EUR 545
Description: Genomics; Genomic Plates

WSE-5300 Printgraph CMOS I 6M UV

2305300 1unit
EUR 8510
Description: I ncl udes 312 nm U V t r ansi l l umi nat or , Whi t e L EDl i ght pl at e CE marked

Bacillus cereus UV DNA damage endonuclease (uvsE)

1-CSB-EP467668BQP
  • EUR 611.00
  • EUR 309.00
  • EUR 1827.00
  • EUR 939.00
  • EUR 1218.00
  • EUR 397.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 44.0 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Bacillus cereus UV DNA damage endonuclease(uvsE) expressed in E.coli

uv table 8w 365/254nm 20x20 cm

VLTCP-20LC ea
EUR 1282

uv table 8w 365/312nm 20x20 cm

VLTCP-20LM ea
EUR 1282

uv table 8w 312/254nm 20x20 cm

VLTCP-20MC ea
EUR 1282

uv table 2x8w, 365/254nm 21x26 cm

VLTCP-26LC ea
EUR 1620

uv table 2x8w, 365/312nm 21x26 cm

VLTCP-26LM ea
EUR 1620

uv table 2x8w, 312/254nm 21x26 cm

VLTCP-26MC ea
EUR 1620

UV excision repair protein RAD23 homolog A Antibody

20-abx110497
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

UV Radiation Resistance-Associated Gene Protein (UVRAG) Antibody

20-abx006162
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

UV Radiation Resistance-Associated Gene Protein (UVRAG) Antibody

abx030355-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

UV Radiation Resistance-Associated Gene Protein (UVRAG) Antibody

abx030355-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

UV Radiation Resistance-Associated Gene Protein (UVRAG) Antibody

abx030356-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

UV Radiation Resistance-Associated Gene Protein (UVRAG) Antibody

abx030356-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

UV Radiation Resistance-Associated Gene Protein (UVRAG) Antibody

abx030357-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

UV Radiation Resistance-Associated Gene Protein (UVRAG) Antibody

abx030357-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

UV Radiation Resistance-Associated Gene Protein (UVRAG) Antibody

abx030358-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

UV Radiation Resistance-Associated Gene Protein (UVRAG) Antibody

abx030358-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

UV Radiation Resistance-Associated Gene Protein (UVRAG) Antibody

20-abx313923
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

UV Radiation Resistance-Associated Gene Protein (UVRAG) Antibody

abx448488-100ug 100 ug
EUR 523
  • Shipped within 5-12 working days.

UV Radiation Resistance-Associated Gene Protein (UVRAG) Antibody

abx448489-100ug 100 ug
EUR 523
  • Shipped within 5-12 working days.

UV Radiation Resistance-Associated Gene Protein (UVRAG) Antibody

abx239352-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

One-Step Lumitein UV Protein Gel Stain, 1X

21005-1L 1L
EUR 222
Description: Minimum order quantity: 1 unit of 1L

One-Step Lumitein UV Protein Gel Stain, 1X

21005-4L 4L
EUR 567
Description: Minimum order quantity: 1 unit of 4L

One-Step Lumitein UV Protein Gel Stain, 1X

21005-F 25mL
EUR 50
Description: Minimum order quantity: 1 unit of 25mL

uv table 8w 254nm/wl 2x(20x20) cm

VLTFP-CWL ea
EUR 1535

uv table 8w 365nm/wl 2x(20x20) cm

VLTFP-LWL ea
EUR 1535

uv table 8w 312nm/wl 2x(20x20) cm

VLTFP-MWL ea
EUR 1535

Replacement power supply for nUVaClean UV Pipette Carousel

P5590-PS 1/pack
EUR 76.33
Description: Replacement power supply for nUVaClean UV Pipette Carousel

BioWand Personal UV Sanitizer, 265-280nm, 1/ea

U1001-W 1/pack
EUR 96.58
Description: BioWand Personal UV Sanitizer 265-280nm

UV excision repair protein RAD23 homolog A Antibody (HRP)

20-abx109043
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

UV Excision Repair Protein RAD23 Homolog B (RAD23B) Antibody

abx159674-100ul 100 ul
EUR 467
  • Shipped within 5-10 working days.

UV excision repair protein RAD23 homolog A Antibody (Biotin)

20-abx106211
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

UV excision repair protein RAD23 homolog A Antibody (FITC)

20-abx107625
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

UV Radiation Resistance-Associated Gene Protein (UVRAG) Antibody (HRP)

20-abx313924
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

UV Radiation Resistance-Associated Gene Protein (UVRAG) Antibody (FITC)

20-abx313925
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

UV Radiation Resistance-Associated Gene Protein (UVRAG) Antibody (Biotin)

20-abx313926
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

UV Excision Repair Protein RAD23 Homolog A (RAD23A) Antibody

abx224223-100ug 100 ug
EUR 411
  • Shipped within 5-10 working days.

UV Radiation Resistance-Associated Gene Protein (UVRAG) Antibody (ALP)

abx446398-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.

UV Radiation Resistance-Associated Gene Protein (UVRAG) Antibody (ALP)

abx446399-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.

UV Radiation Resistance-Associated Gene Protein (UVRAG) Antibody (APC)

abx446400-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.

UV Radiation Resistance-Associated Gene Protein (UVRAG) Antibody (APC)

abx446401-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.

UV Radiation Resistance-Associated Gene Protein (UVRAG) Antibody (Biotin)

abx446402-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.

UV Radiation Resistance-Associated Gene Protein (UVRAG) Antibody (Biotin)

abx446403-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.

UV Radiation Resistance-Associated Gene Protein (UVRAG) Antibody (FITC)

abx446404-100ug 100 ug
EUR 565
  • Shipped within 5-12 working days.

UV Radiation Resistance-Associated Gene Protein (UVRAG) Antibody (FITC)

abx446405-100ug 100 ug
EUR 565
  • Shipped within 5-12 working days.

UV Radiation Resistance-Associated Gene Protein (UVRAG) Antibody (HRP)

abx446406-100ug 100 ug
EUR 565
  • Shipped within 5-12 working days.

UV Radiation Resistance-Associated Gene Protein (UVRAG) Antibody (HRP)

abx446407-100ug 100 ug
EUR 565
  • Shipped within 5-12 working days.

UV Radiation Resistance-Associated Gene Protein (UVRAG) Antibody (PerCP)

abx446410-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.

UV Radiation Resistance-Associated Gene Protein (UVRAG) Antibody (PerCP)

abx446411-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.

UV Radiation Resistance-Associated Gene Protein (UVRAG) Antibody (RPE)

abx446412-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.

UV Radiation Resistance-Associated Gene Protein (UVRAG) Antibody (RPE)

abx446413-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.

UV Radiation Resistance-Associated Gene Protein (UVRAG) Antibody (Streptavidin)

abx446414-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.

UV Radiation Resistance-Associated Gene Protein (UVRAG) Antibody (Streptavidin)

abx446415-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.

Human UV-Stimulated Scaffold Protein A (UVSSA) ELISA Kit

abx388132-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

UV excision repair protein RAD23 homolog A Polyclonal Antibody

42402-100ul 100ul
EUR 333

PhosphoWorks™ Colorimetric MESG Phosphate Assay Kit *UV absorption*

21659 200 Tests
EUR 306
  • R-phrase: R20, R21, R22
  • H-Phrase: H303, H313, H333
  • Symbol for dangerous compounds: Xn
  • UNSPEC Code: 12352200

Human UV excision repair protein RAD23 homolog A (RAD23A)

1-CSB-YP019259HU
  • EUR 430.00
  • EUR 234.00
  • EUR 1508.00
  • EUR 642.00
  • EUR 1009.00
  • EUR 291.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 41.6 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human UV excision repair protein RAD23 homolog A(RAD23A) expressed in Yeast

Human UV excision repair protein RAD23 homolog A (RAD23A)

1-CSB-EP019259HU
  • EUR 380.00
  • EUR 214.00
  • EUR 1309.00
  • EUR 560.00
  • EUR 873.00
  • EUR 262.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 66.6 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human UV excision repair protein RAD23 homolog A(RAD23A) expressed in E.coli

OxiSelect UV-Induced DNA Damage ELISA Kit (CPD Quantitation)

STA-322 96 assays
EUR 659
Description: Our OxiSelect UV-Induced DNA Damage ELISA Kit measures the formation of cyclobutane pyrimidine dimers (CPD) in DNA isolated from cells or tissues. Standards or unknown DNA samples are first heat denatured before adsorbed onto a 96-well DNA binding plate.  The sample or standard are then probed with an anti-CPD antibody, followed by an HRP conjugated secondary antibody. 

OxiSelect UV-Induced DNA Damage ELISA Kit (CPD Quantitation)

STA-322-5 5 x 96 assays
EUR 2671
Description: Our OxiSelect UV-Induced DNA Damage ELISA Kit measures the formation of cyclobutane pyrimidine dimers (CPD) in DNA isolated from cells or tissues. Standards or unknown DNA samples are first heat denatured before adsorbed onto a 96-well DNA binding plate.  The sample or standard are then probed with an anti-CPD antibody, followed by an HRP conjugated secondary antibody. 

OxiSelect Cellular UV-Induced DNA Damage ELISA Kit (CPD)

STA-326 96 assays
EUR 659
Description: Our OxiSelect Cellular UV-Induced DNA Damage ELISA Kit mesaures the formation of cyclobutane pyrimidine dimers (CPD) in intact cells. Cells are first seeded in a 96-well tissue culture plate. Wells are then UV irradiated to induce DNA damage. After fixation and denaturation, cells containing the DNA lesions are probed with an anti-CPD antibody, followed by an HRP conjugated secondary antibody.

OxiSelect Cellular UV-Induced DNA Damage ELISA Kit (CPD)

STA-326-5 5 x 96 assays
EUR 2671
Description: Our OxiSelect Cellular UV-Induced DNA Damage ELISA Kit mesaures the formation of cyclobutane pyrimidine dimers (CPD) in intact cells. Cells are first seeded in a 96-well tissue culture plate. Wells are then UV irradiated to induce DNA damage. After fixation and denaturation, cells containing the DNA lesions are probed with an anti-CPD antibody, followed by an HRP conjugated secondary antibody.

OxiSelect Cellular UV-Induced DNA Damage Staining Kit (CPD)

STA-327 96 assays
EUR 659
Description: Our OxiSelect Cellular UV-Induced DNA Damage Staining Kit measures the formation of cyclobutane pyrimidine dimers (CPD) by immunofluorescence. Cells are first seeded in a 96-well tissue culture plate. Wells are then UV irradiated to induce DNA damage. After fixation and denaturation, cells containing the DNA lesions are probed with an anti-CPD antibody, followed by a FITC conjugated secondary antibody. The unbound secondary antibody is removed during a wash step, and stained cells can then be visualized with a fluorescence microscope.

Absolute Mag Streptavidin Magnetic Particles, Fluorescent UV/Light Yellow

WHM-S123 2 mL
EUR 736

MEM With Earle's Salts , with L-glutamine

CM041-050 500ml
EUR 74

MEM With Earle's Salts , with L-glutamine

CM041-300 6x500ml
EUR 165

MEM With Earle's Salts , with L-glutamine

CM041-310 10x500ml
EUR 205

MEM With Earle's Salts , with L-glutamine

CM041-320 20x500ml
EUR 317

MEM With Earle's Salts , with L-glutamine

CM041-350 50x500ml
EUR 585

MEM With Earle's Salts , with L-glutamine

CM043-050 500ml
EUR 77

MEM With Earle's Salts , with L-glutamine

CM043-300 6x500ml
EUR 166

MEM With Earle's Salts , with L-glutamine

CM043-310 10x500ml
EUR 205

MEM With Earle's Salts , with L-glutamine

CM043-320 20x500ml
EUR 334

MEM With Earle's Salts , with L-glutamine

CM043-350 50x500ml
EUR 585

MEM With Earle's Salts , with L-glutamine

CM044-050 500ml
EUR 77

MEM With Earle's Salts , with L-glutamine

CM044-300 500ml
EUR 166

MEM With Earle's Salts , with L-glutamine

CM044-310 10x500ml
EUR 205

MEM With Earle's Salts , with L-glutamine

CM044-320 20x500ml
EUR 334

Thus far, greater than 80 papers have been revealed that describe the outcomes of the GWAS evaluation in barley. SNP identification related to economically necessary traits and their transformation into CAPS or KASP markers handy for screening choice materials considerably expands the probabilities of marker-assisted choice of barley. As well as, the presently obtainable data on potential goal genes and the standard of the entire barley genome sequence gives base for making use of genome modifying applied sciences to create materials for the creation of types with desired properties.

A Rapid NGS-Based Preimplantation Genetic Testing for Chromosomal Abnormalities in Day-3 Blastomere Biopsy Allows Embryo Transfer Within the Same Treatment Cycle

A Rapid NGS-Based Preimplantation Genetic Testing for Chromosomal Abnormalities in Day-3 Blastomere Biopsy Allows Embryo Transfer Within the Same Treatment Cycle

These days, many of the preimplantation genetic testing (PGT) is carried out with a method of complete chromosome screening and trophectoderm biopsy. However, sufferers with ovarian insufficiency could not have competent blastocysts. Within the current examine, we aimed to ascertain the worth of a number of annealing and looping-based amplification cycle (MALBAC)-based next-generation sequencing (NGS) for PGT in day-Three embryos. A complete of 94.3% (1168/1239) of embryos yielded informative outcomes, and the general embryo euploid charge was 21.9% (256/1168).

Total, 225 embryos have been transferred in 169 cycles with a medical being pregnant charge of 49.1% (83/169). The stay start and implantation charges have been 47.3% (80/169) and 44.4% (100/225), respectively. Double embryos switch confirmed greater medical being pregnant and stay start charges in contrast with single embryo switch, however the implantation charges have been comparable (44.2% vs. 44.6%, P > 0.05). The euploid charge for reciprocal translocations (16.1%) was considerably decrease than that for Robertsonian translocations (28.0%, P < 0.01) and inversions (28.0%, P < 0.01). Nonetheless, greater percentages of embryos with de novo abnormalities have been noticed with Robertsonian translocations (23.3%, P < 0.01) and inversions (30.5%, P < 0.01) than with reciprocal translocations (11.6%).

From Sep. 2016 to Aug. 2018, a complete of six {couples} participated on this examine. 4 instances carried DMD exon deletions and two carried exon duplications. Trophectoderm cells have been biopsied at day 5 or 6 and NGS was used within the genetic testing of the biopsied cells after whole-genome amplification. We developed a brand new method-DIRected Embryonic Cell Testing of Exon Deletion/Duplication (DIRECTED) to instantly detect the single-gene mutation by NGS. Linage evaluation based mostly on single-nucleotide polymorphism (SNP) was used to validate the outcomes from DIRECTED.

 Within the 4 deletion instances, DIRECTED was used to detect DMD exon deletion in 16 biopsied embryos. All DIRECTED outcomes have been in line with linkage evaluation, indicating this technique was dependable in detecting deletions round 1 Mb. Within the two instances carrying exon duplications, no blastocyst was obtained for biopsy. Nonetheless, preliminary experiment outcomes urged that DIRECTED may be used for direct detection of exon duplications in embryos. We demonstrated that NGS for PGT on day-Three embryos is an efficient medical software, significantly for sufferers with a diminished ovarian reserve and restricted embryos.

Subsequent-Era Sequencing (NGS)-Primarily based Preimplantation Genetic Testing for Aneuploidy (PGT-A) of Trophectoderm Biopsy for Recurrent Implantation Failure (RIF) Sufferers: a Retrospective Research

Recurrent implantation failure (RIF) is an intrigue situation throughout in vitro fertilization (IVF) cycles or intracytoplasmic sperm injection (ICSI) remedies. The aim of this retrospective examine is to discover the worth of next-generation sequencing (NGS)-based preimplantation genetic testing for aneuploidy (PGT-A) of trophectoderm biopsy within the medical outcomes for RIF sufferers with superior age. A complete of 265 RIF sufferers, who underwent 346 oocyte retrieval cycles and 250 PGT-A cycles, have been categorised as two teams in keeping with the feminine age, together with < 38 and ≥ 38 years outdated teams.

The 2 teams have been statistically comparable in baseline traits. The part of aneuploid embryos was considerably greater in superior age group than in youthful age group (68.9 vs 39.9%, P < 0.001). However there have been no statistically vital variations in being pregnant charge (43.5 vs 64.7%), medical being pregnant charge (39.1 vs 48.0%), implantation charge (39.1 vs 51.0%), and miscarriage charge (4.Three vs 7.8%) per embryo switch (ET) between the 2 teams. Outcomes counsel that the embryo-related issue performs an important position in RIF. Maternal age doesn’t affect the implantation potential of euploid blastocysts.

The NGS-based PGT-A involving trophectoderm biopsy is efficacious for RIF sufferers of superior age by enhancing their medical outcomes. In conclusion, the NGS-based PGT-A involving trophectoderm biopsy could symbolize a invaluable complement to the present RIF administration. Nonetheless, these findings ought to be additional validated in a well-designed randomized managed trial.

A Rapid NGS-Based Preimplantation Genetic Testing for Chromosomal Abnormalities in Day-3 Blastomere Biopsy Allows Embryo Transfer Within the Same Treatment Cycle

Sanger sequencing is not all the time needed based mostly on a single-center validation of 1109 NGS variants in 825 medical exomes

Regardless of the improved accuracy of next-generation sequencing (NGS), it’s extensively accepted that variants have to be validated utilizing Sanger sequencing earlier than reporting. Validation of all NGS variants significantly will increase the turnaround time and prices of medical prognosis. We comprehensively assessed this want in 1109 variants from 825 medical exomes, the biggest pattern set up to now assessed utilizing Illumina chemistry reported. With a concordance of 100%, we conclude that Sanger sequencing might be very helpful as an inside high quality management, however not a lot as a verification technique for high-quality single-nucleotide and small insertion/deletions variants.

Laboratories would possibly validate and set up their very own thresholds earlier than discontinuing Sanger affirmation research. We additionally increase and validate 23 copy quantity variations detected by exome sequencing in 20 samples, observing a concordance of 95.65%.  47 sufferers have been enrolled for additional evaluation. A last prognosis was accessible in 27 instances together with Eight adverse controls. In 43/47 (91.5%) of sufferers a KRAS- and/or GNAS-mutation was identified by NGS. 27.0% of the KRAS-mutated and 10.0% of the GNAS-mutated lesions harbored a number of mutations. KRAS/GNAS-testing by NGS, cytology, and CEA had a sensitivity and specificity of 94.7/100%, 38.1/100% and 42.1/75.0%, respectively.

transilluminator led 20x12 cm + hood

BLOOK ea
EUR 580

Accuris™ UV Transilluminator

BM0298 Ea
EUR 1306

PMA-Lite LED Photolysis Device

E90002 1EA
EUR 2211
Description: Minimum order quantity: 1 unit of 1EA

Gel-Bright LED Gel Illuminator

E90003 1EA
EUR 773
Description: Minimum order quantity: 1 unit of 1EA

Glo-Plate Blue LED Illuminator

E90004 1EA
EUR 717
Description: Minimum order quantity: 1 unit of 1EA

uv table blue led 20x20 cm

VLECX-20BLUE ea
EUR 1535

Accuris™ UV Transilluminator, 230V input

BM0299 Ea
EUR 1306

WUV-M20, UV Transilluminator, 312nm, 100V

3532197 1unit
EUR 1627

WUV-M20, UV Transilluminator, 312nm, 220V

3532198 1unit
EUR 1627

Sealing Mats for 96 Well Format

GP501 5 mats
EUR 147

uv transilluminator 20x20cm, 312nm, 50/100% switch

UVTR2200 ea
EUR 1161

Pressure Sealing Mats for 384 Well Format

GP504 5 mats
EUR 196

PGE2 Multi-Format EIA kit (One Plate)

K051-H1 1x96 well plate
EUR 379

PGE2 Multi-Format EIA kit (Five Plate)

K051-H5 5x96 well plate
EUR 1344

LARGE siRNA

20-abx922269
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

LARGE siRNA

20-abx922270
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

LARGE antibody

70R-6856 50 ug
EUR 467
Description: Rabbit polyclonal LARGE antibody raised against the middle region of LARGE

CytoSelect 96-Well Phagocytosis Assay (E. coli, Colorimetric Format)

CBA-222 96 assays
EUR 693
Description: Phagocytosis can be assayed by measuring the engulfment of a cell "substrate". However, traditional assays require tedious cell counting under a microscope. Our CytoSelect 96-Well Phagocytosis Assay, E. coli Substrate provides a more accurate, user-friendly, high-throughput alternative to the standard phagocytosis assay. The assay may be adapted for use with 24-well or 48-well plates.

LARGE ELISA Kit| chicken Glycosyltransferase-like protein LARGE

EF012373 96 Tests
EUR 689

Large-CRP OmcBProtein

20-abx600013
  • EUR 843.00
  • EUR 439.00
  • EUR 1274.00
  • EUR 1636.00
  • EUR 551.00
  • 100 ug
  • 10 ug
  • 200 ug
  • 500 ug
  • 50 ug
  • Shipped within 1 month.

Large-CRP OmcBProtein

20-abx600014
  • EUR 2764.00
  • EUR 1734.00
  • 100 ug
  • 50 ug
  • Shipped within 3 months.

LARGE cloning plasmid

CSB-CL012749HU-10ug 10ug
EUR 745
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2271
  • Sequence: atgctgggaatctgcagggggagacggaaattcttggctgcctcgttgagtcttctctgcatcccagccatcacctggatttacctgttttctgggagcttcgaagatggaaagcccgtgtctctgtcaccgctggagtcccaggcacacagccccaggtacacggcctccagcc
  • Show more
Description: A cloning plasmid for the LARGE gene.

anti- LARGE antibody

FNab04697 100µg
EUR 548.75
  • Immunogen: like-glycosyltransferase
  • Uniprot ID: O95461
  • Gene ID: 9215
  • Research Area: Metabolism
Description: Antibody raised against LARGE

LARGE Rabbit pAb

A19515-100ul 100 ul Ask for price

LARGE Rabbit pAb

A19515-200ul 200 ul Ask for price

LARGE Rabbit pAb

A19515-20ul 20 ul Ask for price

LARGE Rabbit pAb

A19515-50ul 50 ul
EUR 308

LARGE Blocking Peptide

33R-1247 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of CRYM antibody, catalog no. 70R-1992

Anti-LARGE antibody

PAab04697 100 ug
EUR 386

Anti-LARGE antibody

STJ11100708 50 µl
EUR 287
Description: This gene, which is one of the largest in the human genome, encodes a member of the N-acetylglucosaminyltransferase gene family. It encodes a glycosyltransferase which participates in glycosylation of alpha-dystroglycan, and may carry out the synthesis of glycoprotein and glycosphingolipid sugar chains. It may also be involved in the addition of a repeated disaccharide unit. Mutations in this gene cause MDC1D, a novel form of congenital muscular dystrophy with severe mental retardation and abnormal glycosylation of alpha-dystroglycan. Alternative splicing of this gene results in two transcript variants that encode the same protein.

Spatulas (Large Pack)

SPAT1 50pack
EUR 301
Description: Individually wrapped spatulas. RNase/DNase free, non-pyrogenic, antistatic, sterile, plastic. Pack of 50.

Retinol Binding Protein (RBP) Multi-format EIA Kit (One Plate)

K062-H1 1x96 well plate
EUR 369

Retinol Binding Protein (RBP) Multi-format EIA Kit (Five Plate)

K062-H5 5x96 well plate
EUR 1344

Large-CRP OmcB Protein

20-abx600002
  • EUR 1970.00
  • EUR 3919.00
  • EUR 2541.00
  • EUR 1414.00
  • 100 ug
  • 1 mg
  • 500 ug
  • 50 ug
  • Shipped within 3 months.

Large-CRP OmcB Protein

20-abx600012
  • EUR 2486.00
  • EUR 1455.00
  • EUR 1622.00
  • EUR 1107.00
  • 1 mg
  • 200 ug
  • 500 ug
  • 50 ug
  • Shipped within 3 months.

Chicken LARGE ELISA KIT

ELI-08774c 96 Tests
EUR 928

LARGE ELISA KIT|Human

EF010620 96 Tests
EUR 689

Like Glycosyltransferase (LARGE) Antibody

20-abx124463
  • EUR 411.00
  • EUR 592.00
  • 100 ul
  • 200 ul
  • Shipped within 5-10 working days.

Like Glycosyltransferase (LARGE) Antibody

20-abx128114
  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Rubisco (Large Chain) Antibody

20-abx159680
  • EUR 272.00
  • EUR 230.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Rubisco (Large Chain) Antibody

20-abx159681
  • EUR 272.00
  • EUR 230.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Rubisco Large Chain Antibody

20-abx134717
  • EUR 356.00
  • EUR 537.00
  • EUR 217.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

Rubisco Antibody (Large Chain)

abx332842-100ul 100 ul
EUR 425
  • Shipped within 5-10 working days.

Like Glycosyltransferase (LARGE) Antibody

abx432911-200ul 200 ul
EUR 384
  • Shipped within 1-3 working days.

Like Glycosyltransferase (LARGE) Antibody

abx432912-200ul 200 ul
EUR 286
  • Shipped within 1-3 working days.

Like Glycosyltransferase (LARGE) Antibody

abx234697-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

Human LARGE shRNA Plasmid

20-abx956100
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Caspase-12 Antibody (Large)

24208-100ul 100ul
EUR 390

Mouse LARGE shRNA Plasmid

20-abx971279
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Recombinant Like Glycosyltransferase (LARGE)

4-RPH936Hu01
  • EUR 467.36
  • EUR 228.00
  • EUR 1477.60
  • EUR 559.20
  • EUR 1018.40
  • EUR 376.00
  • EUR 3544.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: O95461
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 47.0kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human Like Glycosyltransferase expressed in: E.coli

LARGE Recombinant Protein (Human)

RP040651 100 ug Ask for price

pSG5 Large T Plasmid

PVT15908 2 ug
EUR 325

LARGE Recombinant Protein (Rat)

RP207821 100 ug Ask for price

LARGE Recombinant Protein (Mouse)

RP146864 100 ug Ask for price

Measuring Spoon (Large Pack)

SPN1 200pack
EUR 479
Description: Individually wrapped 1.2mL spoons. Sterile. Pack of 200.

CytoSelect 24-Well Cell Migration Assay (8 µm, Colorimetric Format), Trial Size

CBA-100-T 4 assays
EUR 299
Description: Chemotaxis describes the movement of cells toward or away from a chemical stimulus in their environment. Cell chemotaxis plays a pivotal role in the progression of cancer and other diseases. CytoSelect Cell Migration Assays are ideal for determining the chemotactic properties of cells. The 8 µm pore size is suitable for most cell types including epithelial cells, fibroblasts, and cancer cell lines.

CytoSelect 24-Well Cell Migration Assay (8 µm, Fluorometric Format), Trial Size

CBA-101-T 4 assays
EUR 299
Description: Chemotaxis describes the movement of cells toward or away from a chemical stimulus in their environment. Cell chemotaxis plays a pivotal role in the progression of cancer and other diseases. CytoSelect Cell Migration Assays are ideal for determining the chemotactic properties of cells. The 8 µm pore size is suitable for most cell types including epithelial cells, fibroblasts, and cancer cell lines.

CytoSelect 24-Well Cell Migration Assay (5 µm, Fluorometric Format), Trial Size

CBA-102-T 4 assays
EUR 299
Description: Chemotaxis describes the movement of cells toward or away from a chemical stimulus in their environment. Cell chemotaxis plays a pivotal role in the progression of cancer and other diseases. CytoSelect Cell Migration Assays are ideal for determining the chemotactic properties of cells. The 5 µm pore size is ideal for monocytes / macrophages.

CytoSelect 24-Well Cell Migration Assay (3 µm, Fluorometric Format), Trial Size

CBA-103-T 4 assays
EUR 299
Description: Chemotaxis describes the movement of cells toward or away from a chemical stimulus in their environment. Cell chemotaxis plays a pivotal role in the progression of cancer and other diseases. CytoSelect Cell Migration Assays are ideal for determining the chemotactic properties of cells. The 3 µm pore size is best for the smallest cells including neutrophils and other leukocytes.

CytoSelect 24-Well Cell Invasion Assay (Basement Membrane, Colorimetric Format), Trial Size

CBA-110-T 4 assays
EUR 322
Description: The ability of malignant tumor cells to invade normal surrounding tissue contributes in large part to the morbidity and mortality of cancers. Cell invasion requires several distinct cellular functions including adhesion, motility, detachment, and extracellular matrix proteolysis. Our CytoSelect Cell Invasion Assays utilize precoated inserts to assay the invasive properties of tumor cells. Invasive cells can be quantified in 24-well plates on either a standard microplate reader or a fluorescence plate reader. Inserts are precoated on the top of the membrane with ECM matrix gel (basement membrane), a protein mix isolated from EHS tumor cells.

CytoSelect 24-Well Cell Invasion Assay (Basement Membrane, Fluorometric Format), Trial Size

CBA-111-T 4 assays
EUR 322
Description: The ability of malignant tumor cells to invade normal surrounding tissue contributes in large part to the morbidity and mortality of cancers. Cell invasion requires several distinct cellular functions including adhesion, motility, detachment, and extracellular matrix proteolysis. Our CytoSelect Cell Invasion Assays utilize precoated inserts to assay the invasive properties of tumor cells. Invasive cells can be quantified in 24-well plates on either a standard microplate reader or a fluorescence plate reader. Inserts are precoated on the top of the membrane with ECM matrix gel (basement membrane), a protein mix isolated from EHS tumor cells.

Large T Antigen (LT) Protein

20-abx654150
  • EUR 648.00
  • EUR 272.00
  • EUR 1998.00
  • EUR 773.00
  • EUR 467.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Polyclonal Caspase-12 Antibody (Large)

APR06327G 0.1 mg
EUR 659
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human Caspase-12 (Large). This antibody is tested and proven to work in the following applications:

Large DNA Fragment Extraction Kit

FYG204-100P 100 Preps Ask for price

Large DNA Fragment Extraction Kit

FYG204-300P 300 Preps Ask for price

SV40 large T antigen NLS

HY-P0310 5mg
EUR 491

Rubisco(Large Chain) Monoclonal Antibody

EM1214-100ul 100ul
EUR 279
Description: A Mouse Monoclonal antibody against Rubisco(Large Chain) from Plants. This antibody is tested and validated for WB, ELISA

Rubisco(Large Chain) Monoclonal Antibody

EM1214-50ul 50ul
EUR 207
Description: A Mouse Monoclonal antibody against Rubisco(Large Chain) from Plants. This antibody is tested and validated for WB, ELISA

Ribosomal Protein, Large, P0 Antibody

20-abx115279
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Human Like Glycosyltransferase (LARGE) Protein

20-abx166585
  • EUR 648.00
  • EUR 272.00
  • EUR 1998.00
  • EUR 773.00
  • EUR 467.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Rubisco (Large Chain) Monoclonal Antibody

ABM40217-003ml 0.03ml
EUR 158
  • Immunogen information: Protein
  • Applications tips:
Description: A monoclonal antibody for detection of Rubisco Large Chain) from Plants. This Rubisco Large Chain) antibody is for WB. It is affinity-purified from mouse ascites by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in mouse by using as an immunogen Protein

Rubisco (Large Chain) Monoclonal Antibody

ABM40217-01ml 0.1ml
EUR 289
  • Immunogen information: Protein
  • Applications tips:
Description: A monoclonal antibody for detection of Rubisco Large Chain) from Plants. This Rubisco Large Chain) antibody is for WB. It is affinity-purified from mouse ascites by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in mouse by using as an immunogen Protein

Rubisco (Large Chain) Monoclonal Antibody

ABM40217-02ml 0.2ml
EUR 414
  • Immunogen information: Protein
  • Applications tips:
Description: A monoclonal antibody for detection of Rubisco Large Chain) from Plants. This Rubisco Large Chain) antibody is for WB. It is affinity-purified from mouse ascites by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in mouse by using as an immunogen Protein

Rubisco (Large Chain) Monoclonal Antibody

ABM40218-003ml 0.03ml
EUR 158
  • Immunogen information: Protein
  • Applications tips:
Description: A monoclonal antibody for detection of Rubisco Large Chain) from Plants. This Rubisco Large Chain) antibody is for WB. It is affinity-purified from mouse ascites by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in mouse by using as an immunogen Protein

Rubisco (Large Chain) Monoclonal Antibody

ABM40218-01ml 0.1ml
EUR 289
  • Immunogen information: Protein
  • Applications tips:
Description: A monoclonal antibody for detection of Rubisco Large Chain) from Plants. This Rubisco Large Chain) antibody is for WB. It is affinity-purified from mouse ascites by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in mouse by using as an immunogen Protein

Rubisco (Large Chain) Monoclonal Antibody

ABM40218-02ml 0.2ml
EUR 414
  • Immunogen information: Protein
  • Applications tips:
Description: A monoclonal antibody for detection of Rubisco Large Chain) from Plants. This Rubisco Large Chain) antibody is for WB. It is affinity-purified from mouse ascites by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in mouse by using as an immunogen Protein

Large T Antigen (LT) Antibody

20-abx177313
  • EUR 1233.00
  • EUR 592.00
  • 1 mg
  • 200 ug
  • Please enquire.

Large ORF Vector (Rat) (pORF)

ORF069275 1.0 ug DNA
EUR 506

Bst DNA Polymerase, Large Fragment

M1213-200
EUR 289

Bsu DNA Polymerase Large Fragment

M1214-200
EUR 398

h LARGE inducible lentiviral particles

LVP603 1x107 IFU/ml x 200ul
EUR 451
Description: Pre-made over-expression lentivirus for expressing human target: LARGE (like-glycosyltransferase (LARGE)), [alternative names: MDC1D; MDDGA6; MDDGB6]. The sub-cloned codon sequence is identical (100% match) to CDS region in NCBI ID: NM_133642.3. It also contains a RFP-Blasticidin dual selection marker.

Large ORF Vector (Mouse) (pORF)

ORF048956 1.0 ug DNA
EUR 506

LARGE ORF Vector (Human) (pORF)

ORF013551 1.0 ug DNA
EUR 354

Bst DNA Polymerase Large Fragment

P701-01 800 U
EUR 122

Bst DNA Polymerase Large Fragment

P701-02 8000 U
EUR 271

Anti-LARGE (aa421-433) antibody

STJ72207 100 µg
EUR 359

Anti-LARGE (N-terminus) antibody

STJ72208 100 µg
EUR 260

Anti-Rubisco (Large Chain) antibody

STJ97527 200 µl
EUR 197
Description: Mouse monoclonal to Rubisco (Large Chain) (3G7).

Anti-Rubisco (Large Chain) antibody

STJ97528 200 µl
EUR 197
Description: Mouse monoclonal to Rubisco (Large Chain) (1H1).

Recombinant MeV Large Polymerase Protein

VAng-Lsx0385-inquire inquire Ask for price
Description: Recombinant MeV Large Polymerase containing the large polymerase immunodominant regions, 58-149 amino acids was expressed in E. coli and purified by proprietary chromatographic technique.

Scoops Material Stainless Steel, Large

SP076 1 UNIT
EUR 57.4
  • Product category: Labware/Lab Accessories/Scoops

96-Well Cellular Senescence Assay Kit (SA-?-gal Activity, Fluorometric Format), Trial Size

CBA-231-T 24 assays
EUR 345
Description: Our Cellular Senescence Activity Assay provides an efficient method to measure Senescence Associated (SA) ß-galactosidase activity. SA-ß-Gal catalyzes the hydrolysis of X-gal, which produces a blue color in senescent cells. Quantify senescence using a fluorescence plate reader.

Active Calpain 1, Large Subunit (CAPN1)

4-APB964Ra01
  • EUR 749.60
  • EUR 304.00
  • EUR 2536.00
  • EUR 912.00
  • EUR 1724.00
  • EUR 565.00
  • EUR 6190.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P97571
  • Buffer composition: 20mM Tris, 150mM NaCl, pH8.0, containing 1mM EDTA, 1mM DTT, 0.01% SKL, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 33.5kDa
  • Isoelectric Point: 5.3
Description: Recombinant Rat Calpain 1, Large Subunit expressed in: E.coli

Active Calpain 1, Large Subunit (CAPN1)

4-APB964Ra02
  • EUR 749.60
  • EUR 304.00
  • EUR 2536.00
  • EUR 912.00
  • EUR 1724.00
  • EUR 565.00
  • EUR 6190.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P97571
  • Buffer composition: 20mM Tris, 150mM NaCl, pH8.0, containing 1mM EDTA, 1mM DTT, 0.01% SKL, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 37.2kDa
  • Isoelectric Point: 5.9
Description: Recombinant Rat Calpain 1, Large Subunit expressed in: E.coli

Human Large Intestine Microvascular Endothelial Cells

HEC16 500,000+ Cells Frozen
EUR 1080

Disks Large Homolog 1 (DLG1) Antibody

20-abx124281
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Discs Large Homolog 4 (DLG4) Antibody

20-abx125325
  • EUR 495.00
  • EUR 704.00
  • EUR 356.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.

Calpain 2, Large Subunit (CAPN2) Antibody

20-abx111330
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Discs, Large Homolog 3 (DLG3) Antibody

20-abx112100
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Discs, Large Homolog 5 (DLG5) Antibody

20-abx112101
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Calpain 1, Large Subunit (CAPN1) Antibody

20-abx128598
  • EUR 411.00
  • EUR 133.00
  • EUR 1149.00
  • EUR 565.00
  • EUR 314.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Discs, Large Homolog 3 (DLG3) Antibody

20-abx129226
  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Large Multifunctional Peptidase 2 (LMP2) Antibody

20-abx129728
  • EUR 411.00
  • EUR 133.00
  • EUR 1135.00
  • EUR 551.00
  • EUR 314.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Discs, Large Homolog 5 (DLG5) Antibody

20-abx131277
  • EUR 439.00
  • EUR 133.00
  • EUR 1233.00
  • EUR 592.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Discs, Large Homolog 5 (DLG5) Antibody

20-abx131278
  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Calpain 2, Large Subunit (CAPN2) Antibody

20-abx109593
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Disks Large Homolog 1 (DLG1) Antibody

20-abx149846
  • EUR 425.00
  • EUR 342.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Disks Large Homolog 3 (DLG3) Antibody

20-abx149847
  • EUR 425.00
  • EUR 342.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Calpain 1, Large Subunit (CAPN1) Antibody

20-abx102521
  • EUR 411.00
  • EUR 133.00
  • EUR 1149.00
  • EUR 565.00
  • EUR 314.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Calpain 1, Large Subunit (CAPN1) Antibody

20-abx102522
  • EUR 425.00
  • EUR 133.00
  • EUR 1177.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.

Calpain 1, Large Subunit (CAPN1) Antibody

20-abx102523
  • EUR 425.00
  • EUR 133.00
  • EUR 1177.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Calpain 1, Large Subunit (CAPN1) Antibody

20-abx102524
  • EUR 439.00
  • EUR 133.00
  • EUR 1247.00
  • EUR 592.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.

Calpain 1, Large Subunit (CAPN1) Antibody

20-abx102525
  • EUR 439.00
  • EUR 133.00
  • EUR 1247.00
  • EUR 592.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Large Multifunctional Peptidase 7 (LMP7) Antibody

20-abx103454
  • EUR 411.00
  • EUR 133.00
  • EUR 1149.00
  • EUR 565.00
  • EUR 314.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Large Multifunctional Peptidase 7 (LMP7) Antibody

20-abx103455
  • EUR 425.00
  • EUR 133.00
  • EUR 1177.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Large Multifunctional Peptidase 7 (LMP7) Antibody

20-abx103456
  • EUR 439.00
  • EUR 133.00
  • EUR 1233.00
  • EUR 592.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Calpain 2, Large Subunit (CAPN2) Antibody

20-abx104994
  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Discs Large Homolog 4 (DLG4) Antibody

20-abx007353
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Discs Large Homolog 4 (DLG4) Antibody

20-abx004732
  • EUR 495.00
  • EUR 356.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Discs, Large Homolog 3 (DLG3) Antibody

20-abx172137
  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.

Discs, Large Homolog 4 (DLG4) Antibody

20-abx172138
  • EUR 913.00
  • EUR 467.00
  • 1 mg
  • 200 ug
  • Please enquire.

Large Multifunctional Peptidase 2 (LMP2) Antibody

20-abx173310
  • EUR 787.00
  • EUR 411.00
  • 1 mg
  • 200 ug
  • Please enquire.

Discs, Large Homolog 4 (DLG4) Antibody

20-abx176180
  • EUR 439.00
  • EUR 133.00
  • EUR 1233.00
  • EUR 592.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Discs, Large Homolog 4 (DLG4) Antibody

20-abx176181
  • EUR 1233.00
  • EUR 592.00
  • 1 mg
  • 200 ug
  • Please enquire.

Discs, Large Homolog 4 (DLG4) Antibody

20-abx176182
  • EUR 453.00
  • EUR 133.00
  • EUR 1302.00
  • EUR 620.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.

Large Proline-Rich Protein (BAG6) Antibody

20-abx176872
  • EUR 1233.00
  • EUR 592.00
  • 1 mg
  • 200 ug
  • Please enquire.

Large Proline-Rich Protein (BAG6) Antibody

20-abx176873
  • EUR 1233.00
  • EUR 592.00
  • 1 mg
  • 200 ug
  • Please enquire.

Large Multifunctional Peptidase 2 (LMP2) Antibody

20-abx177311
  • EUR 398.00
  • EUR 133.00
  • EUR 1107.00
  • EUR 537.00
  • EUR 314.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Large-Conductance Mechanosensitive Channel (mscL) Antibody

20-abx300814
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Large Multifunctional Peptidase 2 (LMP2) Antibody

20-abx319932
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Calpain 2, Large Subunit (CAPN2) Antibody

20-abx326567
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Discs, Large Homolog 4 (DLG4) Antibody

20-abx327113
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Discs, Large Homolog 4 (DLG4) Antibody

20-abx214479
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Calpain 2, Large Subunit (CAPN2) Antibody

20-abx214702
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Calpain 2, Large Subunit (CAPN2) Antibody

20-abx214703
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Discs, Large Homolog 4 (DLG4) Antibody

20-abx214930
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Disks Large Homolog 2 (DLG2) Antibody

20-abx338845
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Disks Large Homolog 1 (DLG1) Antibody

20-abx317333
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Disks Large Homolog 1 (DLG1) Antibody

abx432611-200ul 200 ul
EUR 384
  • Shipped within 1-3 working days.

Discs Large Homolog 4 (DLG4) Antibody

abx430064-200ul 200 ul
EUR 384
  • Shipped within 1-3 working days.

Large Multifunctional Peptidase 2 (LMP2) Antibody

abx234810-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

Disks Large Homolog 1 (DLG1) Antibody

abx232409-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

Disks Large Homolog 3 (DLG3) Antibody

abx232410-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

Disks Large Homolog 5 (DLG5) Antibody

abx232411-100ug 100 ug
EUR 551
  • Shipped within 5-12 working days.

Calpain 1, Large Subunit (CAPN1) Antibody

20-abx171526
  • EUR 815.00
  • EUR 425.00
  • 1 mg
  • 200 ug
  • Please enquire.

Calpain 1, Large Subunit (CAPN1) Antibody

20-abx171527
  • EUR 871.00
  • EUR 453.00
  • 1 mg
  • 200 ug
  • Please enquire.

KRAS/GNAS-testing was considerably superior to CEA (P = 0,0209) and cytology (P = 0.0016). In conclusion, KRAS/GNAS-testing by deep focused NGS is an acceptable technique to tell apart mucinous from non-mucinous pancreatic lesions, suggesting its utilization as a single diagnostic check. Outcomes have to be confirmed in a bigger cohort. This text is protected by copyright. All rights reserved.

IHC versus FISH versus NGS to detect ALK gene rearrangement in NSCLC: all questions answered?

IHC versus FISH versus NGS to detect ALK gene rearrangement in NSCLC: all questions answered?

Anaplastic lymphoma kinase (ALK) rearranged non-small cell lung carcinoma (NSCLC) is a definite molecular subtype and speedy approval of ALK tyrosine kinase inhibitors (TKIs) has necessitated speedy and delicate diagnostic modalities for the detection of this alteration. Gene rearrangements might be recognized utilizing many strategies together with fluorescence in situ hybridisation (FISH), reverse transcriptase-PCR, next-generation sequencing (NGS) and immunohistochemistry (IHC) for fusion oncoprotein expression. We aimed to find out the concordance between IHC, FISH and NGS for ALK biomarker detection, and decide variations in sensitivity, and survival outcomes.
We analysed the concordance between IHC utilizing D5F3 monoclonal antibody, FISH (break-apart) and NGS utilizing a customized panel containing 71 totally different ALK variants. Amongst 71 instances included on this examine, FISH was evaluable in 58 instances. The concordance of ALK IHC with FISH was 75.9% and that with NGS was 84.5%. The sensitivities of FISH and NGS have been 75.6% and 87.5%, respectively. The median progression-free survival of ALK IHC-positive and FISH-negative group was 5.5 months and that of each constructive was 9.97 months. Regardless of intensive analysis and an extended historical past of glucocorticoids being utilized in varied medical areas, they nonetheless generate a problem for customized medication by inflicting resistance or dependence in practically 50% of sufferers handled.
The target of the current examine was to find out the genetic predictors of variable reactions in inflammatory bowel illness sufferers to glucocorticoid remedy. Evaluation of all of the focused DNA sequences for the entire affected person group indicated 121 totally different useful variants. After affiliation analyses of 31 chosen variants, the polymorphism c.1088A>G within the NR3C1 gene was linked with glucocorticoid resistance (p = 0.002), variant c.241+6A>G of the FKBP5 gene with glucocorticoid sensitivity (p = 0.040), and deletion c.306-7delT within the MAPK14 gene with an hostile therapeutic impact (dependency and resistance, p = 0.041) in ulcerative colitis sufferers.

Affiliation of Postoperative Biomarker Response with Recurrence and Survival in Sufferers with Hepatocellular Carcinoma and Excessive Alpha-Fetoprotein Expressions (>400 ng/ml)

Excessive alpha-fetoprotein (AFP) expressions (>400 ng/mL) are related to poor oncological traits for hepatocellular carcinoma (HCC). Nevertheless, prognosis after liver resection for high-AFP HCC is poorly studied. To research long-term recurrence and survival after hepatectomy for high-AFP HCC, and to establish the predictive worth of postoperative incomplete biomarker response (IBR) on general survival (OS) and recurrence-free survival (RFS). In Crohn’s illness, the change c.2685+49T>C of the ABCB1 gene associated to glucocorticoid resistance (p = 0.034).
Sufferers present process healing resection for high-AFP HCC have been analyzed. In line with the decline magnitude of serum AFP as measured at first follow-up (4~6 weeks after surgical procedure), all sufferers have been divided into the whole biomarker response (CBR) and IBR teams. Traits, recurrence, and survival charges have been in contrast. Univariate and Multivariate Cox-regression analyses have been carried out to establish impartial predictors related to poorer OS and RFS after liver resection for high-AFP HCC.
Amongst 549 sufferers, the general and early recurrence charges in sufferers with IBR have been considerably larger than sufferers with CBR. On multivariate evaluation, postoperative IBR was the strongest danger issue with the best hazard ratio in predicting poor OS and RFS.
Postoperative biomarker response of serum AFP can be utilized in predicting recurrence and survival for high-AFP HCC sufferers. As soon as postoperative IBR was recognized at first follow-up, subsequent enhanced recurrence surveillance and accessible remedies towards recurrence ought to actively be thought of. Holocene have been reconstructed. The research on intraspecific gene stream and homoploid hybridization targeted on hybrid swarms Pinus sylvestris/P. mugo and firs.
IHC versus FISH versus NGS to detect ALK gene rearrangement in NSCLC: all questions answered?

18F-fluciclovine PET/CT detection of biochemical recurrent prostate most cancers in sufferers with PSA ranges <2.00 ng/mL

To ascertain the detection price of prostate most cancers recurrence following definitive remedy by 18F-fluciclovine PET/computed tomography (CT) in sufferers with biochemical recurrence (BCR) and prostate-specific antigen (PSA) ranges lower than 2.00 ng/mL. On this retrospective examine, 78 sufferers with a PSA degree of lower than 2.00 ng/mL have been chosen from the 211 sufferers who underwent no less than one 18F-fluciclovine PET/CT scan at our establishment for the detection of biochemical recurrent prostate most cancers between April 2017 and December 2018. Inherent variations within the traits of sufferers with and with out a constructive scan have been investigated for potential associations utilizing multivariable evaluation.
A number of constructive websites of recurrence have been recognized in 44 out of 78 sufferers (56.4%). Sufferers with a Gleason rating between eight and 10 have been extra prone to have a constructive scan in comparison with sufferers with Gleason scores of 6-7 [adjusted odds ratio: 3.53, 95% confidence interval (1.13-10.99), P = 0.03]. No different vital affiliation was discovered between PSA, T classification, and detection price. 18F-fluciclovine PET/CT demonstrated a detection price of 56.4% amongst sufferers with a PSA under 2.Zero ng/mL. The outcomes of this examine assist the usage of 18F-fluciclovine PET/CT for the detection of recurrent prostate most cancers at decrease PSA ranges, even at PSA ranges lower than 0.5 ng/mL
WUV-M20, UV Transilluminator, 312nm, 220V
3532198 1unit
EUR 1627
FBS-HI - Heat Inactivated Fetal Bovine Serum
FBS001-HI 500 ml
EUR 564
uv transilluminator 20x20cm, 312nm, 50/100% switch
UVTR2200 ea
EUR 1161
BLook: LED Transilluminator
BK001 1 pcs Ask for price
transilluminator led 20x12 cm + hood
BLOOK ea
EUR 580
HI TOPK 032
B5640-10 10 mg
EUR 203
HI TOPK 032
B5640-5 5 mg
EUR 137
HI-TOPK-032
HY-101550 100mg
EUR 849
Osteoprotegerin Hi-5 Protein
20-abx263246
  • EUR 1609.00
  • EUR 328.00
  • EUR 230.00
  • 100 ug
  • 10 ug
  • 2 µg
  • Shipped within 5-10 working days.
Fluorescent UV Particles
FP-15040-2 2 mL
EUR 283
Description: Please reffer to the technical data sheet for more detail information for this item. Our dedicated team would be happy to assist you via live chat, email or phone.
UV TRANSMITTING TRAY
GD-GCS 1/pk
EUR 208
Description: Lab Equipment; Axygen Branded EQ
uv protected glasses
VLLP70 ea
EUR 99
SensiFAST Genotyping Hi-Rox Kit
BIO-35005 500 Reactions Ask for price
SensiFAST Genotyping Hi-ROX Mix
BIO-35020 2000 rxns Ask for price
Hi-Fi Reaction Buffer, 5x
BIO-37110 2 x 1.5ml Ask for price
SensiFAST Probe Hi-ROX Kit
BIO-82002/S Sample Ask for price
SensiFAST Probe Hi-ROX Kit
BIO-82005 500 rxns Ask for price
SensiFAST Probe Hi-ROX Kit
BIO-82020 2000 rxns Ask for price
SensiFAST SYBR Hi-ROX Kit
BIO-92002/S Sample Ask for price
SensiFAST SYBR Hi-ROX Kit
BIO-92005 500 rxns Ask for price
SensiFAST SYBR Hi-ROX Kit
BIO-92020 2000 rxns Ask for price
EBV Bam HI-Z Antibody
abx021695-1mg 1 mg
EUR 1156
  • Shipped within 5-10 working days.
Recombinant Human Osteoprotegerin Hi-5
7-01327 2µg Ask for price
Recombinant Human Osteoprotegerin Hi-5
7-01328 10µg Ask for price
Recombinant Human Osteoprotegerin Hi-5
7-01329 100µg Ask for price
Hi-Bind? Protein G-Agarose
6513-1
EUR 234
Hi-Bind? Protein G-Agarose
6513-100