These days, many of the preimplantation genetic testing (PGT) is carried out with a method of complete chromosome screening and trophectoderm biopsy. However, sufferers with ovarian insufficiency could not have competent blastocysts. Within the current examine, we aimed to ascertain the worth of a number of annealing and looping-based amplification cycle (MALBAC)-based next-generation sequencing (NGS) for PGT in day-Three embryos. A complete of 94.3% (1168/1239) of embryos yielded informative outcomes, and the general embryo euploid charge was 21.9% (256/1168).
Total, 225 embryos have been transferred in 169 cycles with a medical being pregnant charge of 49.1% (83/169). The stay start and implantation charges have been 47.3% (80/169) and 44.4% (100/225), respectively. Double embryos switch confirmed greater medical being pregnant and stay start charges in contrast with single embryo switch, however the implantation charges have been comparable (44.2% vs. 44.6%, P > 0.05). The euploid charge for reciprocal translocations (16.1%) was considerably decrease than that for Robertsonian translocations (28.0%, P < 0.01) and inversions (28.0%, P < 0.01). Nonetheless, greater percentages of embryos with de novo abnormalities have been noticed with Robertsonian translocations (23.3%, P < 0.01) and inversions (30.5%, P < 0.01) than with reciprocal translocations (11.6%).
From Sep. 2016 to Aug. 2018, a complete of six {couples} participated on this examine. 4 instances carried DMD exon deletions and two carried exon duplications. Trophectoderm cells have been biopsied at day 5 or 6 and NGS was used within the genetic testing of the biopsied cells after whole-genome amplification. We developed a brand new method-DIRected Embryonic Cell Testing of Exon Deletion/Duplication (DIRECTED) to instantly detect the single-gene mutation by NGS. Linage evaluation based mostly on single-nucleotide polymorphism (SNP) was used to validate the outcomes from DIRECTED.
Within the 4 deletion instances, DIRECTED was used to detect DMD exon deletion in 16 biopsied embryos. All DIRECTED outcomes have been in line with linkage evaluation, indicating this technique was dependable in detecting deletions round 1 Mb. Within the two instances carrying exon duplications, no blastocyst was obtained for biopsy. Nonetheless, preliminary experiment outcomes urged that DIRECTED may be used for direct detection of exon duplications in embryos. We demonstrated that NGS for PGT on day-Three embryos is an efficient medical software, significantly for sufferers with a diminished ovarian reserve and restricted embryos.
Subsequent-Era Sequencing (NGS)-Primarily based Preimplantation Genetic Testing for Aneuploidy (PGT-A) of Trophectoderm Biopsy for Recurrent Implantation Failure (RIF) Sufferers: a Retrospective Research
Recurrent implantation failure (RIF) is an intrigue situation throughout in vitro fertilization (IVF) cycles or intracytoplasmic sperm injection (ICSI) remedies. The aim of this retrospective examine is to discover the worth of next-generation sequencing (NGS)-based preimplantation genetic testing for aneuploidy (PGT-A) of trophectoderm biopsy within the medical outcomes for RIF sufferers with superior age. A complete of 265 RIF sufferers, who underwent 346 oocyte retrieval cycles and 250 PGT-A cycles, have been categorised as two teams in keeping with the feminine age, together with < 38 and ≥ 38 years outdated teams.
The 2 teams have been statistically comparable in baseline traits. The part of aneuploid embryos was considerably greater in superior age group than in youthful age group (68.9 vs 39.9%, P < 0.001). However there have been no statistically vital variations in being pregnant charge (43.5 vs 64.7%), medical being pregnant charge (39.1 vs 48.0%), implantation charge (39.1 vs 51.0%), and miscarriage charge (4.Three vs 7.8%) per embryo switch (ET) between the 2 teams. Outcomes counsel that the embryo-related issue performs an important position in RIF. Maternal age doesn’t affect the implantation potential of euploid blastocysts.
The NGS-based PGT-A involving trophectoderm biopsy is efficacious for RIF sufferers of superior age by enhancing their medical outcomes. In conclusion, the NGS-based PGT-A involving trophectoderm biopsy could symbolize a invaluable complement to the present RIF administration. Nonetheless, these findings ought to be additional validated in a well-designed randomized managed trial.

Sanger sequencing is not all the time needed based mostly on a single-center validation of 1109 NGS variants in 825 medical exomes
Regardless of the improved accuracy of next-generation sequencing (NGS), it’s extensively accepted that variants have to be validated utilizing Sanger sequencing earlier than reporting. Validation of all NGS variants significantly will increase the turnaround time and prices of medical prognosis. We comprehensively assessed this want in 1109 variants from 825 medical exomes, the biggest pattern set up to now assessed utilizing Illumina chemistry reported. With a concordance of 100%, we conclude that Sanger sequencing might be very helpful as an inside high quality management, however not a lot as a verification technique for high-quality single-nucleotide and small insertion/deletions variants.
Laboratories would possibly validate and set up their very own thresholds earlier than discontinuing Sanger affirmation research. We additionally increase and validate 23 copy quantity variations detected by exome sequencing in 20 samples, observing a concordance of 95.65%. 47 sufferers have been enrolled for additional evaluation. A last prognosis was accessible in 27 instances together with Eight adverse controls. In 43/47 (91.5%) of sufferers a KRAS- and/or GNAS-mutation was identified by NGS. 27.0% of the KRAS-mutated and 10.0% of the GNAS-mutated lesions harbored a number of mutations. KRAS/GNAS-testing by NGS, cytology, and CEA had a sensitivity and specificity of 94.7/100%, 38.1/100% and 42.1/75.0%, respectively.
transilluminator led 20x12 cm + hood |
BLOOK |
Consort |
ea |
EUR 580 |
Accuris™ UV Transilluminator |
BM0298 |
GenDepot |
Ea |
EUR 1306 |
PMA-Lite LED Photolysis Device |
E90002 |
Biotium |
1EA |
EUR 2211 |
Description: Minimum order quantity: 1 unit of 1EA |
Gel-Bright LED Gel Illuminator |
E90003 |
Biotium |
1EA |
EUR 773 |
Description: Minimum order quantity: 1 unit of 1EA |
Glo-Plate Blue LED Illuminator |
E90004 |
Biotium |
1EA |
EUR 717 |
Description: Minimum order quantity: 1 unit of 1EA |
uv table blue led 20x20 cm |
VLECX-20BLUE |
Consort |
ea |
EUR 1535 |
Accuris™ UV Transilluminator, 230V input |
BM0299 |
GenDepot |
Ea |
EUR 1306 |
WUV-M20, UV Transilluminator, 312nm, 100V |
3532197 |
Atto |
1unit |
EUR 1627 |
WUV-M20, UV Transilluminator, 312nm, 220V |
3532198 |
Atto |
1unit |
EUR 1627 |
Sealing Mats for 96 Well Format |
GP501 |
GenDepot |
5 mats |
EUR 147 |
uv transilluminator 20x20cm, 312nm, 50/100% switch |
UVTR2200 |
Consort |
ea |
EUR 1161 |
Pressure Sealing Mats for 384 Well Format |
GP504 |
GenDepot |
5 mats |
EUR 196 |
PGE2 Multi-Format EIA kit (One Plate) |
K051-H1 |
Arbor Assays |
1x96 well plate |
EUR 379 |
PGE2 Multi-Format EIA kit (Five Plate) |
K051-H5 |
Arbor Assays |
5x96 well plate |
EUR 1344 |
LARGE siRNA |
20-abx922269 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
LARGE siRNA |
20-abx922270 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
LARGE antibody |
70R-6856 |
Fitzgerald |
50 ug |
EUR 467 |
Description: Rabbit polyclonal LARGE antibody raised against the middle region of LARGE |
CytoSelect 96-Well Phagocytosis Assay (E. coli, Colorimetric Format) |
CBA-222 |
Cell Biolabs |
96 assays |
EUR 693 |
Description: Phagocytosis can be assayed by measuring the engulfment of a cell "substrate". However, traditional assays require tedious cell counting under a microscope. Our CytoSelect 96-Well Phagocytosis Assay, E. coli Substrate provides a more accurate, user-friendly, high-throughput alternative to the standard phagocytosis assay. The assay may be adapted for use with 24-well or 48-well plates. |
LARGE ELISA Kit| chicken Glycosyltransferase-like protein LARGE |
EF012373 |
Lifescience Market |
96 Tests |
EUR 689 |
Large-CRP OmcBProtein |
20-abx600013 |
Abbexa |
-
EUR 843.00
-
EUR 439.00
-
EUR 1274.00
-
EUR 1636.00
-
EUR 551.00
|
-
100 ug
-
10 ug
-
200 ug
-
500 ug
-
50 ug
|
|
Large-CRP OmcBProtein |
20-abx600014 |
Abbexa |
|
|
|
LARGE cloning plasmid |
CSB-CL012749HU-10ug |
Cusabio |
10ug |
EUR 745 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 2271
- Sequence: atgctgggaatctgcagggggagacggaaattcttggctgcctcgttgagtcttctctgcatcccagccatcacctggatttacctgttttctgggagcttcgaagatggaaagcccgtgtctctgtcaccgctggagtcccaggcacacagccccaggtacacggcctccagcc
- Show more
|
Description: A cloning plasmid for the LARGE gene. |
anti- LARGE antibody |
FNab04697 |
FN Test |
100µg |
EUR 548.75 |
- Immunogen: like-glycosyltransferase
- Uniprot ID: O95461
- Gene ID: 9215
- Research Area: Metabolism
|
Description: Antibody raised against LARGE |
LARGE Rabbit pAb |
A19515-100ul |
Abclonal |
100 ul |
Ask for price |
LARGE Rabbit pAb |
A19515-200ul |
Abclonal |
200 ul |
Ask for price |
LARGE Rabbit pAb |
A19515-20ul |
Abclonal |
20 ul |
Ask for price |
LARGE Rabbit pAb |
A19515-50ul |
Abclonal |
50 ul |
EUR 308 |
LARGE Blocking Peptide |
33R-1247 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of CRYM antibody, catalog no. 70R-1992 |
Anti-LARGE antibody |
STJ11100708 |
St John's Laboratory |
50 µl |
EUR 287 |
Description: This gene, which is one of the largest in the human genome, encodes a member of the N-acetylglucosaminyltransferase gene family. It encodes a glycosyltransferase which participates in glycosylation of alpha-dystroglycan, and may carry out the synthesis of glycoprotein and glycosphingolipid sugar chains. It may also be involved in the addition of a repeated disaccharide unit. Mutations in this gene cause MDC1D, a novel form of congenital muscular dystrophy with severe mental retardation and abnormal glycosylation of alpha-dystroglycan. Alternative splicing of this gene results in two transcript variants that encode the same protein. |
Spatulas (Large Pack) |
SPAT1 |
Next Advance |
50pack |
EUR 301 |
Description: Individually wrapped spatulas. RNase/DNase free, non-pyrogenic, antistatic, sterile, plastic. Pack of 50. |
Retinol Binding Protein (RBP) Multi-format EIA Kit (One Plate) |
K062-H1 |
Arbor Assays |
1x96 well plate |
EUR 369 |
Retinol Binding Protein (RBP) Multi-format EIA Kit (Five Plate) |
K062-H5 |
Arbor Assays |
5x96 well plate |
EUR 1344 |
Large-CRP OmcB Protein |
20-abx600002 |
Abbexa |
-
EUR 1970.00
-
EUR 3919.00
-
EUR 2541.00
-
EUR 1414.00
|
|
|
Large-CRP OmcB Protein |
20-abx600012 |
Abbexa |
-
EUR 2486.00
-
EUR 1455.00
-
EUR 1622.00
-
EUR 1107.00
|
|
|
Like Glycosyltransferase (LARGE) Antibody |
20-abx124463 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Like Glycosyltransferase (LARGE) Antibody |
20-abx128114 |
Abbexa |
-
EUR 425.00
-
EUR 133.00
-
EUR 1205.00
-
EUR 578.00
-
EUR 328.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Rubisco (Large Chain) Antibody |
20-abx159680 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Rubisco (Large Chain) Antibody |
20-abx159681 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Rubisco Large Chain Antibody |
20-abx134717 |
Abbexa |
-
EUR 356.00
-
EUR 537.00
-
EUR 217.00
|
|
- Shipped within 5-10 working days.
|
Rubisco Antibody (Large Chain) |
abx332842-100ul |
Abbexa |
100 ul |
EUR 425 |
- Shipped within 5-10 working days.
|
Like Glycosyltransferase (LARGE) Antibody |
abx432911-200ul |
Abbexa |
200 ul |
EUR 384 |
- Shipped within 1-3 working days.
|
Like Glycosyltransferase (LARGE) Antibody |
abx432912-200ul |
Abbexa |
200 ul |
EUR 286 |
- Shipped within 1-3 working days.
|
Like Glycosyltransferase (LARGE) Antibody |
abx234697-100ug |
Abbexa |
100 ug |
EUR 509 |
- Shipped within 5-12 working days.
|
Human LARGE shRNA Plasmid |
20-abx956100 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Caspase-12 Antibody (Large) |
24208-100ul |
SAB |
100ul |
EUR 390 |
Mouse LARGE shRNA Plasmid |
20-abx971279 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Recombinant Like Glycosyltransferase (LARGE) |
4-RPH936Hu01 |
Cloud-Clone |
-
EUR 467.36
-
EUR 228.00
-
EUR 1477.60
-
EUR 559.20
-
EUR 1018.40
-
EUR 376.00
-
EUR 3544.00
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: O95461
- Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 47.0kDa
- Isoelectric Point: Inquire
|
Description: Recombinant Human Like Glycosyltransferase expressed in: E.coli |
LARGE Recombinant Protein (Human) |
RP040651 |
ABM |
100 ug |
Ask for price |
LARGE Recombinant Protein (Rat) |
RP207821 |
ABM |
100 ug |
Ask for price |
LARGE Recombinant Protein (Mouse) |
RP146864 |
ABM |
100 ug |
Ask for price |
Measuring Spoon (Large Pack) |
SPN1 |
Next Advance |
200pack |
EUR 479 |
Description: Individually wrapped 1.2mL spoons. Sterile. Pack of 200. |
CytoSelect 24-Well Cell Migration Assay (8 µm, Colorimetric Format), Trial Size |
CBA-100-T |
Cell Biolabs |
4 assays |
EUR 299 |
Description: Chemotaxis describes the movement of cells toward or away from a chemical stimulus in their environment. Cell chemotaxis plays a pivotal role in the progression of cancer and other diseases. CytoSelect Cell Migration Assays are ideal for determining the chemotactic properties of cells. The 8 µm pore size is suitable for most cell types including epithelial cells, fibroblasts, and cancer cell lines. |
CytoSelect 24-Well Cell Migration Assay (8 µm, Fluorometric Format), Trial Size |
CBA-101-T |
Cell Biolabs |
4 assays |
EUR 299 |
Description: Chemotaxis describes the movement of cells toward or away from a chemical stimulus in their environment. Cell chemotaxis plays a pivotal role in the progression of cancer and other diseases. CytoSelect Cell Migration Assays are ideal for determining the chemotactic properties of cells. The 8 µm pore size is suitable for most cell types including epithelial cells, fibroblasts, and cancer cell lines. |
CytoSelect 24-Well Cell Migration Assay (5 µm, Fluorometric Format), Trial Size |
CBA-102-T |
Cell Biolabs |
4 assays |
EUR 299 |
Description: Chemotaxis describes the movement of cells toward or away from a chemical stimulus in their environment. Cell chemotaxis plays a pivotal role in the progression of cancer and other diseases. CytoSelect Cell Migration Assays are ideal for determining the chemotactic properties of cells. The 5 µm pore size is ideal for monocytes / macrophages. |
CytoSelect 24-Well Cell Migration Assay (3 µm, Fluorometric Format), Trial Size |
CBA-103-T |
Cell Biolabs |
4 assays |
EUR 299 |
Description: Chemotaxis describes the movement of cells toward or away from a chemical stimulus in their environment. Cell chemotaxis plays a pivotal role in the progression of cancer and other diseases. CytoSelect Cell Migration Assays are ideal for determining the chemotactic properties of cells. The 3 µm pore size is best for the smallest cells including neutrophils and other leukocytes. |
CytoSelect 24-Well Cell Invasion Assay (Basement Membrane, Colorimetric Format), Trial Size |
CBA-110-T |
Cell Biolabs |
4 assays |
EUR 322 |
Description: The ability of malignant tumor cells to invade normal surrounding tissue contributes in large part to the morbidity and mortality of cancers. Cell invasion requires several distinct cellular functions including adhesion, motility, detachment, and extracellular matrix proteolysis. Our CytoSelect Cell Invasion Assays utilize precoated inserts to assay the invasive properties of tumor cells. Invasive cells can be quantified in 24-well plates on either a standard microplate reader or a fluorescence plate reader. Inserts are precoated on the top of the membrane with ECM matrix gel (basement membrane), a protein mix isolated from EHS tumor cells. |
CytoSelect 24-Well Cell Invasion Assay (Basement Membrane, Fluorometric Format), Trial Size |
CBA-111-T |
Cell Biolabs |
4 assays |
EUR 322 |
Description: The ability of malignant tumor cells to invade normal surrounding tissue contributes in large part to the morbidity and mortality of cancers. Cell invasion requires several distinct cellular functions including adhesion, motility, detachment, and extracellular matrix proteolysis. Our CytoSelect Cell Invasion Assays utilize precoated inserts to assay the invasive properties of tumor cells. Invasive cells can be quantified in 24-well plates on either a standard microplate reader or a fluorescence plate reader. Inserts are precoated on the top of the membrane with ECM matrix gel (basement membrane), a protein mix isolated from EHS tumor cells. |
Large T Antigen (LT) Protein |
20-abx654150 |
Abbexa |
-
EUR 648.00
-
EUR 272.00
-
EUR 1998.00
-
EUR 773.00
-
EUR 467.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-15 working days.
|
Polyclonal Caspase-12 Antibody (Large) |
APR06327G |
Leading Biology |
0.1 mg |
EUR 659 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human Caspase-12 (Large). This antibody is tested and proven to work in the following applications: |
Large DNA Fragment Extraction Kit |
FYG204-100P |
Yeastern Biotech |
100 Preps |
Ask for price |
Large DNA Fragment Extraction Kit |
FYG204-300P |
Yeastern Biotech |
300 Preps |
Ask for price |
Rubisco(Large Chain) Monoclonal Antibody |
EM1214-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Mouse Monoclonal antibody against Rubisco(Large Chain) from Plants. This antibody is tested and validated for WB, ELISA |
Rubisco(Large Chain) Monoclonal Antibody |
EM1214-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Mouse Monoclonal antibody against Rubisco(Large Chain) from Plants. This antibody is tested and validated for WB, ELISA |
Ribosomal Protein, Large, P0 Antibody |
20-abx115279 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Human Like Glycosyltransferase (LARGE) Protein |
20-abx166585 |
Abbexa |
-
EUR 648.00
-
EUR 272.00
-
EUR 1998.00
-
EUR 773.00
-
EUR 467.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Rubisco (Large Chain) Monoclonal Antibody |
ABM40217-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Protein
- Applications tips:
|
Description: A monoclonal antibody for detection of Rubisco Large Chain) from Plants. This Rubisco Large Chain) antibody is for WB. It is affinity-purified from mouse ascites by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in mouse by using as an immunogen Protein |
Rubisco (Large Chain) Monoclonal Antibody |
ABM40217-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Protein
- Applications tips:
|
Description: A monoclonal antibody for detection of Rubisco Large Chain) from Plants. This Rubisco Large Chain) antibody is for WB. It is affinity-purified from mouse ascites by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in mouse by using as an immunogen Protein |
Rubisco (Large Chain) Monoclonal Antibody |
ABM40217-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Protein
- Applications tips:
|
Description: A monoclonal antibody for detection of Rubisco Large Chain) from Plants. This Rubisco Large Chain) antibody is for WB. It is affinity-purified from mouse ascites by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in mouse by using as an immunogen Protein |
Rubisco (Large Chain) Monoclonal Antibody |
ABM40218-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Protein
- Applications tips:
|
Description: A monoclonal antibody for detection of Rubisco Large Chain) from Plants. This Rubisco Large Chain) antibody is for WB. It is affinity-purified from mouse ascites by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in mouse by using as an immunogen Protein |
Rubisco (Large Chain) Monoclonal Antibody |
ABM40218-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Protein
- Applications tips:
|
Description: A monoclonal antibody for detection of Rubisco Large Chain) from Plants. This Rubisco Large Chain) antibody is for WB. It is affinity-purified from mouse ascites by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in mouse by using as an immunogen Protein |
Rubisco (Large Chain) Monoclonal Antibody |
ABM40218-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Protein
- Applications tips:
|
Description: A monoclonal antibody for detection of Rubisco Large Chain) from Plants. This Rubisco Large Chain) antibody is for WB. It is affinity-purified from mouse ascites by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in mouse by using as an immunogen Protein |
Large T Antigen (LT) Antibody |
20-abx177313 |
Abbexa |
|
|
|
Large ORF Vector (Rat) (pORF) |
ORF069275 |
ABM |
1.0 ug DNA |
EUR 506 |
Bst DNA Polymerase, Large Fragment |
M1213-200 |
Biovision |
|
EUR 289 |
Bsu DNA Polymerase Large Fragment |
M1214-200 |
Biovision |
|
EUR 398 |
h LARGE inducible lentiviral particles |
LVP603 |
GenTarget |
1x107 IFU/ml x 200ul |
EUR 451 |
Description: Pre-made over-expression lentivirus for expressing human target: LARGE (like-glycosyltransferase (LARGE)), [alternative names: MDC1D; MDDGA6; MDDGB6]. The sub-cloned codon sequence is identical (100% match) to CDS region in NCBI ID: NM_133642.3. It also contains a RFP-Blasticidin dual selection marker. |
Large ORF Vector (Mouse) (pORF) |
ORF048956 |
ABM |
1.0 ug DNA |
EUR 506 |
LARGE ORF Vector (Human) (pORF) |
ORF013551 |
ABM |
1.0 ug DNA |
EUR 354 |
Bst DNA Polymerase Large Fragment |
P701-01 |
Vazyme |
800 U |
EUR 122 |
Bst DNA Polymerase Large Fragment |
P701-02 |
Vazyme |
8000 U |
EUR 271 |
Anti-Rubisco (Large Chain) antibody |
STJ97527 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Mouse monoclonal to Rubisco (Large Chain) (3G7). |
Anti-Rubisco (Large Chain) antibody |
STJ97528 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Mouse monoclonal to Rubisco (Large Chain) (1H1). |
Recombinant MeV Large Polymerase Protein |
VAng-Lsx0385-inquire |
Creative Biolabs |
inquire |
Ask for price |
Description: Recombinant MeV Large Polymerase containing the large polymerase immunodominant regions, 58-149 amino acids was expressed in E. coli and purified by proprietary chromatographic technique. |
Scoops Material Stainless Steel, Large |
SP076 |
Bio Basic |
1 UNIT |
EUR 57.4 |
- Product category: Labware/Lab Accessories/Scoops
|
96-Well Cellular Senescence Assay Kit (SA-?-gal Activity, Fluorometric Format), Trial Size |
CBA-231-T |
Cell Biolabs |
24 assays |
EUR 345 |
Description: Our Cellular Senescence Activity Assay provides an efficient method to measure Senescence Associated (SA) ß-galactosidase activity. SA-ß-Gal catalyzes the hydrolysis of X-gal, which produces a blue color in senescent cells. Quantify senescence using a fluorescence plate reader. |
Active Calpain 1, Large Subunit (CAPN1) |
4-APB964Ra01 |
Cloud-Clone |
-
EUR 749.60
-
EUR 304.00
-
EUR 2536.00
-
EUR 912.00
-
EUR 1724.00
-
EUR 565.00
-
EUR 6190.00
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: P97571
- Buffer composition: 20mM Tris, 150mM NaCl, pH8.0, containing 1mM EDTA, 1mM DTT, 0.01% SKL, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 33.5kDa
- Isoelectric Point: 5.3
|
Description: Recombinant Rat Calpain 1, Large Subunit expressed in: E.coli |
Active Calpain 1, Large Subunit (CAPN1) |
4-APB964Ra02 |
Cloud-Clone |
-
EUR 749.60
-
EUR 304.00
-
EUR 2536.00
-
EUR 912.00
-
EUR 1724.00
-
EUR 565.00
-
EUR 6190.00
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: P97571
- Buffer composition: 20mM Tris, 150mM NaCl, pH8.0, containing 1mM EDTA, 1mM DTT, 0.01% SKL, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 37.2kDa
- Isoelectric Point: 5.9
|
Description: Recombinant Rat Calpain 1, Large Subunit expressed in: E.coli |
Human Large Intestine Microvascular Endothelial Cells |
HEC16 |
Neuromics |
500,000+ Cells Frozen |
EUR 1080 |
Disks Large Homolog 1 (DLG1) Antibody |
20-abx124281 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
Discs Large Homolog 4 (DLG4) Antibody |
20-abx125325 |
Abbexa |
-
EUR 495.00
-
EUR 704.00
-
EUR 356.00
|
|
- Shipped within 5-10 working days.
|
Calpain 2, Large Subunit (CAPN2) Antibody |
20-abx111330 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Discs, Large Homolog 3 (DLG3) Antibody |
20-abx112100 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Discs, Large Homolog 5 (DLG5) Antibody |
20-abx112101 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Calpain 1, Large Subunit (CAPN1) Antibody |
20-abx128598 |
Abbexa |
-
EUR 411.00
-
EUR 133.00
-
EUR 1149.00
-
EUR 565.00
-
EUR 314.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Discs, Large Homolog 3 (DLG3) Antibody |
20-abx129226 |
Abbexa |
-
EUR 425.00
-
EUR 133.00
-
EUR 1205.00
-
EUR 578.00
-
EUR 328.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Large Multifunctional Peptidase 2 (LMP2) Antibody |
20-abx129728 |
Abbexa |
-
EUR 411.00
-
EUR 133.00
-
EUR 1135.00
-
EUR 551.00
-
EUR 314.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Discs, Large Homolog 5 (DLG5) Antibody |
20-abx131277 |
Abbexa |
-
EUR 439.00
-
EUR 133.00
-
EUR 1233.00
-
EUR 592.00
-
EUR 328.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Discs, Large Homolog 5 (DLG5) Antibody |
20-abx131278 |
Abbexa |
-
EUR 425.00
-
EUR 133.00
-
EUR 1205.00
-
EUR 578.00
-
EUR 328.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Calpain 2, Large Subunit (CAPN2) Antibody |
20-abx109593 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Disks Large Homolog 1 (DLG1) Antibody |
20-abx149846 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Disks Large Homolog 3 (DLG3) Antibody |
20-abx149847 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Calpain 1, Large Subunit (CAPN1) Antibody |
20-abx102521 |
Abbexa |
-
EUR 411.00
-
EUR 133.00
-
EUR 1149.00
-
EUR 565.00
-
EUR 314.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Calpain 1, Large Subunit (CAPN1) Antibody |
20-abx102522 |
Abbexa |
-
EUR 425.00
-
EUR 133.00
-
EUR 1177.00
-
EUR 578.00
-
EUR 328.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-12 working days.
|
Calpain 1, Large Subunit (CAPN1) Antibody |
20-abx102523 |
Abbexa |
-
EUR 425.00
-
EUR 133.00
-
EUR 1177.00
-
EUR 578.00
-
EUR 328.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Calpain 1, Large Subunit (CAPN1) Antibody |
20-abx102524 |
Abbexa |
-
EUR 439.00
-
EUR 133.00
-
EUR 1247.00
-
EUR 592.00
-
EUR 328.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-12 working days.
|
Calpain 1, Large Subunit (CAPN1) Antibody |
20-abx102525 |
Abbexa |
-
EUR 439.00
-
EUR 133.00
-
EUR 1247.00
-
EUR 592.00
-
EUR 328.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Large Multifunctional Peptidase 7 (LMP7) Antibody |
20-abx103454 |
Abbexa |
-
EUR 411.00
-
EUR 133.00
-
EUR 1149.00
-
EUR 565.00
-
EUR 314.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Large Multifunctional Peptidase 7 (LMP7) Antibody |
20-abx103455 |
Abbexa |
-
EUR 425.00
-
EUR 133.00
-
EUR 1177.00
-
EUR 578.00
-
EUR 328.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Large Multifunctional Peptidase 7 (LMP7) Antibody |
20-abx103456 |
Abbexa |
-
EUR 439.00
-
EUR 133.00
-
EUR 1233.00
-
EUR 592.00
-
EUR 328.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Calpain 2, Large Subunit (CAPN2) Antibody |
20-abx104994 |
Abbexa |
-
EUR 425.00
-
EUR 133.00
-
EUR 1205.00
-
EUR 578.00
-
EUR 328.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Discs Large Homolog 4 (DLG4) Antibody |
20-abx007353 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
Discs Large Homolog 4 (DLG4) Antibody |
20-abx004732 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Discs, Large Homolog 3 (DLG3) Antibody |
20-abx172137 |
Abbexa |
|
|
|
Discs, Large Homolog 4 (DLG4) Antibody |
20-abx172138 |
Abbexa |
|
|
|
Large Multifunctional Peptidase 2 (LMP2) Antibody |
20-abx173310 |
Abbexa |
|
|
|
Discs, Large Homolog 4 (DLG4) Antibody |
20-abx176180 |
Abbexa |
-
EUR 439.00
-
EUR 133.00
-
EUR 1233.00
-
EUR 592.00
-
EUR 328.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Discs, Large Homolog 4 (DLG4) Antibody |
20-abx176181 |
Abbexa |
|
|
|
Discs, Large Homolog 4 (DLG4) Antibody |
20-abx176182 |
Abbexa |
-
EUR 453.00
-
EUR 133.00
-
EUR 1302.00
-
EUR 620.00
-
EUR 342.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-12 working days.
|
Large Proline-Rich Protein (BAG6) Antibody |
20-abx176872 |
Abbexa |
|
|
|
Large Proline-Rich Protein (BAG6) Antibody |
20-abx176873 |
Abbexa |
|
|
|
Large Multifunctional Peptidase 2 (LMP2) Antibody |
20-abx177311 |
Abbexa |
-
EUR 398.00
-
EUR 133.00
-
EUR 1107.00
-
EUR 537.00
-
EUR 314.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Large-Conductance Mechanosensitive Channel (mscL) Antibody |
20-abx300814 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Large Multifunctional Peptidase 2 (LMP2) Antibody |
20-abx319932 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Calpain 2, Large Subunit (CAPN2) Antibody |
20-abx326567 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Discs, Large Homolog 4 (DLG4) Antibody |
20-abx327113 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Discs, Large Homolog 4 (DLG4) Antibody |
20-abx214479 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Calpain 2, Large Subunit (CAPN2) Antibody |
20-abx214702 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Calpain 2, Large Subunit (CAPN2) Antibody |
20-abx214703 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Discs, Large Homolog 4 (DLG4) Antibody |
20-abx214930 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Disks Large Homolog 2 (DLG2) Antibody |
20-abx338845 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Disks Large Homolog 1 (DLG1) Antibody |
20-abx317333 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Disks Large Homolog 1 (DLG1) Antibody |
abx432611-200ul |
Abbexa |
200 ul |
EUR 384 |
- Shipped within 1-3 working days.
|
Discs Large Homolog 4 (DLG4) Antibody |
abx430064-200ul |
Abbexa |
200 ul |
EUR 384 |
- Shipped within 1-3 working days.
|
Large Multifunctional Peptidase 2 (LMP2) Antibody |
abx234810-100ug |
Abbexa |
100 ug |
EUR 481 |
- Shipped within 5-12 working days.
|
Disks Large Homolog 1 (DLG1) Antibody |
abx232409-100ug |
Abbexa |
100 ug |
EUR 481 |
- Shipped within 5-12 working days.
|
Disks Large Homolog 3 (DLG3) Antibody |
abx232410-100ug |
Abbexa |
100 ug |
EUR 481 |
- Shipped within 5-12 working days.
|
Disks Large Homolog 5 (DLG5) Antibody |
abx232411-100ug |
Abbexa |
100 ug |
EUR 551 |
- Shipped within 5-12 working days.
|
Calpain 1, Large Subunit (CAPN1) Antibody |
20-abx171526 |
Abbexa |
|
|
|
Calpain 1, Large Subunit (CAPN1) Antibody |
20-abx171527 |
Abbexa |
|
|
|
KRAS/GNAS-testing was considerably superior to CEA (P = 0,0209) and cytology (P = 0.0016). In conclusion, KRAS/GNAS-testing by deep focused NGS is an acceptable technique to tell apart mucinous from non-mucinous pancreatic lesions, suggesting its utilization as a single diagnostic check. Outcomes have to be confirmed in a bigger cohort. This text is protected by copyright. All rights reserved.