These days, many of the preimplantation genetic testing (PGT) is carried out with a method of complete chromosome screening and trophectoderm biopsy. However, sufferers with ovarian insufficiency could not have competent blastocysts. Within the current examine, we aimed to ascertain the worth of a number of annealing and looping-based amplification cycle (MALBAC)-based next-generation sequencing (NGS) for PGT in day-Three embryos. A complete of 94.3% (1168/1239) of embryos yielded informative outcomes, and the general embryo euploid charge was 21.9% (256/1168).

Total, 225 embryos have been transferred in 169 cycles with a medical being pregnant charge of 49.1% (83/169). The stay start and implantation charges have been 47.3% (80/169) and 44.4% (100/225), respectively. Double embryos switch confirmed greater medical being pregnant and stay start charges in contrast with single embryo switch, however the implantation charges have been comparable (44.2% vs. 44.6%, P > 0.05). The euploid charge for reciprocal translocations (16.1%) was considerably decrease than that for Robertsonian translocations (28.0%, P < 0.01) and inversions (28.0%, P < 0.01). Nonetheless, greater percentages of embryos with de novo abnormalities have been noticed with Robertsonian translocations (23.3%, P < 0.01) and inversions (30.5%, P < 0.01) than with reciprocal translocations (11.6%).

From Sep. 2016 to Aug. 2018, a complete of six {couples} participated on this examine. 4 instances carried DMD exon deletions and two carried exon duplications. Trophectoderm cells have been biopsied at day 5 or 6 and NGS was used within the genetic testing of the biopsied cells after whole-genome amplification. We developed a brand new method-DIRected Embryonic Cell Testing of Exon Deletion/Duplication (DIRECTED) to instantly detect the single-gene mutation by NGS. Linage evaluation based mostly on single-nucleotide polymorphism (SNP) was used to validate the outcomes from DIRECTED.

 Within the 4 deletion instances, DIRECTED was used to detect DMD exon deletion in 16 biopsied embryos. All DIRECTED outcomes have been in line with linkage evaluation, indicating this technique was dependable in detecting deletions round 1 Mb. Within the two instances carrying exon duplications, no blastocyst was obtained for biopsy. Nonetheless, preliminary experiment outcomes urged that DIRECTED may be used for direct detection of exon duplications in embryos. We demonstrated that NGS for PGT on day-Three embryos is an efficient medical software, significantly for sufferers with a diminished ovarian reserve and restricted embryos.

Subsequent-Era Sequencing (NGS)-Primarily based Preimplantation Genetic Testing for Aneuploidy (PGT-A) of Trophectoderm Biopsy for Recurrent Implantation Failure (RIF) Sufferers: a Retrospective Research

Recurrent implantation failure (RIF) is an intrigue situation throughout in vitro fertilization (IVF) cycles or intracytoplasmic sperm injection (ICSI) remedies. The aim of this retrospective examine is to discover the worth of next-generation sequencing (NGS)-based preimplantation genetic testing for aneuploidy (PGT-A) of trophectoderm biopsy within the medical outcomes for RIF sufferers with superior age. A complete of 265 RIF sufferers, who underwent 346 oocyte retrieval cycles and 250 PGT-A cycles, have been categorised as two teams in keeping with the feminine age, together with < 38 and ≥ 38 years outdated teams.

The 2 teams have been statistically comparable in baseline traits. The part of aneuploid embryos was considerably greater in superior age group than in youthful age group (68.9 vs 39.9%, P < 0.001). However there have been no statistically vital variations in being pregnant charge (43.5 vs 64.7%), medical being pregnant charge (39.1 vs 48.0%), implantation charge (39.1 vs 51.0%), and miscarriage charge (4.Three vs 7.8%) per embryo switch (ET) between the 2 teams. Outcomes counsel that the embryo-related issue performs an important position in RIF. Maternal age doesn’t affect the implantation potential of euploid blastocysts.

The NGS-based PGT-A involving trophectoderm biopsy is efficacious for RIF sufferers of superior age by enhancing their medical outcomes. In conclusion, the NGS-based PGT-A involving trophectoderm biopsy could symbolize a invaluable complement to the present RIF administration. Nonetheless, these findings ought to be additional validated in a well-designed randomized managed trial.

A Rapid NGS-Based Preimplantation Genetic Testing for Chromosomal Abnormalities in Day-3 Blastomere Biopsy Allows Embryo Transfer Within the Same Treatment Cycle

Sanger sequencing is not all the time needed based mostly on a single-center validation of 1109 NGS variants in 825 medical exomes

Regardless of the improved accuracy of next-generation sequencing (NGS), it’s extensively accepted that variants have to be validated utilizing Sanger sequencing earlier than reporting. Validation of all NGS variants significantly will increase the turnaround time and prices of medical prognosis. We comprehensively assessed this want in 1109 variants from 825 medical exomes, the biggest pattern set up to now assessed utilizing Illumina chemistry reported. With a concordance of 100%, we conclude that Sanger sequencing might be very helpful as an inside high quality management, however not a lot as a verification technique for high-quality single-nucleotide and small insertion/deletions variants.

Laboratories would possibly validate and set up their very own thresholds earlier than discontinuing Sanger affirmation research. We additionally increase and validate 23 copy quantity variations detected by exome sequencing in 20 samples, observing a concordance of 95.65%.  47 sufferers have been enrolled for additional evaluation. A last prognosis was accessible in 27 instances together with Eight adverse controls. In 43/47 (91.5%) of sufferers a KRAS- and/or GNAS-mutation was identified by NGS. 27.0% of the KRAS-mutated and 10.0% of the GNAS-mutated lesions harbored a number of mutations. KRAS/GNAS-testing by NGS, cytology, and CEA had a sensitivity and specificity of 94.7/100%, 38.1/100% and 42.1/75.0%, respectively.

transilluminator led 20x12 cm + hood

EUR 580

Accuris™ UV Transilluminator

BM0298 Ea
EUR 1306

PMA-Lite LED Photolysis Device

E90002 1EA
EUR 2211
Description: Minimum order quantity: 1 unit of 1EA

Gel-Bright LED Gel Illuminator

E90003 1EA
EUR 773
Description: Minimum order quantity: 1 unit of 1EA

Glo-Plate Blue LED Illuminator

E90004 1EA
EUR 717
Description: Minimum order quantity: 1 unit of 1EA

uv table blue led 20x20 cm

EUR 1535

WUV-M20, UV Transilluminator, 312nm, 100V

3532197 1unit
EUR 1627

WUV-M20, UV Transilluminator, 312nm, 220V

3532198 1unit
EUR 1627

Accuris™ UV Transilluminator, 230V input

BM0299 Ea
EUR 1306

Sealing Mats for 96 Well Format

GP501 5 mats
EUR 147

uv transilluminator 20x20cm, 312nm, 50/100% switch

UVTR2200 ea
EUR 1161

Pressure Sealing Mats for 384 Well Format

GP504 5 mats
EUR 196

PGE2 Multi-Format EIA kit (One Plate)

K051-H1 1x96 well plate
EUR 379

PGE2 Multi-Format EIA kit (Five Plate)

K051-H5 5x96 well plate
EUR 1344

LARGE antibody

70R-6856 50 ug
EUR 467
Description: Rabbit polyclonal LARGE antibody raised against the middle region of LARGE


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

CytoSelect 96-Well Phagocytosis Assay (E. coli, Colorimetric Format)

CBA-222 96 assays
EUR 693
Description: Phagocytosis can be assayed by measuring the engulfment of a cell "substrate". However, traditional assays require tedious cell counting under a microscope. Our CytoSelect 96-Well Phagocytosis Assay, E. coli Substrate provides a more accurate, user-friendly, high-throughput alternative to the standard phagocytosis assay. The assay may be adapted for use with 24-well or 48-well plates.

LARGE ELISA Kit| chicken Glycosyltransferase-like protein LARGE

EF012373 96 Tests
EUR 689

LARGE Blocking Peptide

33R-1247 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of CRYM antibody, catalog no. 70R-1992

Large-CRP OmcBProtein

  • EUR 843.00
  • EUR 439.00
  • EUR 1274.00
  • EUR 1636.00
  • EUR 551.00
  • 100 ug
  • 10 ug
  • 200 ug
  • 500 ug
  • 50 ug
  • Shipped within 1 month.

Large-CRP OmcBProtein

  • EUR 2764.00
  • EUR 1734.00
  • 100 ug
  • 50 ug
  • Shipped within 3 months.

LARGE cloning plasmid

CSB-CL012749HU-10ug 10ug
EUR 745
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2271
  • Sequence: atgctgggaatctgcagggggagacggaaattcttggctgcctcgttgagtcttctctgcatcccagccatcacctggatttacctgttttctgggagcttcgaagatggaaagcccgtgtctctgtcaccgctggagtcccaggcacacagccccaggtacacggcctccagcc
  • Show more
Description: A cloning plasmid for the LARGE gene.

LARGE Rabbit pAb

A19515-100ul 100 ul Ask for price

LARGE Rabbit pAb

A19515-200ul 200 ul Ask for price

LARGE Rabbit pAb

A19515-20ul 20 ul Ask for price

LARGE Rabbit pAb

A19515-50ul 50 ul
EUR 308

anti- LARGE antibody

FNab04697 100µg
EUR 548.75
  • Immunogen: like-glycosyltransferase
  • Uniprot ID: O95461
  • Gene ID: 9215
  • Research Area: Metabolism
Description: Antibody raised against LARGE

Anti-LARGE antibody

PAab04697 100 ug
EUR 386

Anti-LARGE antibody

STJ11100708 50 µl
EUR 287
Description: This gene, which is one of the largest in the human genome, encodes a member of the N-acetylglucosaminyltransferase gene family. It encodes a glycosyltransferase which participates in glycosylation of alpha-dystroglycan, and may carry out the synthesis of glycoprotein and glycosphingolipid sugar chains. It may also be involved in the addition of a repeated disaccharide unit. Mutations in this gene cause MDC1D, a novel form of congenital muscular dystrophy with severe mental retardation and abnormal glycosylation of alpha-dystroglycan. Alternative splicing of this gene results in two transcript variants that encode the same protein.

Spatulas (Large Pack)

SPAT1 50pack
EUR 301
Description: Individually wrapped spatulas. RNase/DNase free, non-pyrogenic, antistatic, sterile, plastic. Pack of 50.

Retinol Binding Protein (RBP) Multi-format EIA Kit (One Plate)

K062-H1 1x96 well plate
EUR 369

Retinol Binding Protein (RBP) Multi-format EIA Kit (Five Plate)

K062-H5 5x96 well plate
EUR 1344

Caspase-12 Antibody (Large)

24208-100ul 100ul
EUR 390

Like Glycosyltransferase (LARGE) Antibody

  • EUR 411.00
  • EUR 592.00
  • 100 ul
  • 200 ul
  • Shipped within 5-10 working days.

Like Glycosyltransferase (LARGE) Antibody

  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Rubisco Large Chain Antibody

  • EUR 356.00
  • EUR 537.00
  • EUR 217.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

Rubisco (Large Chain) Antibody

  • EUR 272.00
  • EUR 230.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Rubisco (Large Chain) Antibody

  • EUR 272.00
  • EUR 230.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.


ELI-08774c 96 Tests
EUR 928


EF010620 96 Tests
EUR 689

Like Glycosyltransferase (LARGE) Antibody

abx234697-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

Rubisco Antibody (Large Chain)

abx332842-100ul 100 ul
EUR 425
  • Shipped within 5-10 working days.

Large-CRP OmcB Protein

  • EUR 1970.00
  • EUR 3919.00
  • EUR 2541.00
  • EUR 1414.00
  • 100 ug
  • 1 mg
  • 500 ug
  • 50 ug
  • Shipped within 3 months.

Large-CRP OmcB Protein

  • EUR 2486.00
  • EUR 1455.00
  • EUR 1622.00
  • EUR 1107.00
  • 1 mg
  • 200 ug
  • 500 ug
  • 50 ug
  • Shipped within 3 months.

Like Glycosyltransferase (LARGE) Antibody

abx432911-200ul 200 ul
EUR 384
  • Shipped within 1-3 working days.

Like Glycosyltransferase (LARGE) Antibody

abx432912-200ul 200 ul
EUR 286
  • Shipped within 1-3 working days.

Human LARGE shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse LARGE shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Recombinant Like Glycosyltransferase (LARGE)

  • EUR 467.36
  • EUR 228.00
  • EUR 1477.60
  • EUR 559.20
  • EUR 1018.40
  • EUR 376.00
  • EUR 3544.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: O95461
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 47.0kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human Like Glycosyltransferase expressed in: E.coli

pSG5 Large T Plasmid

PVT15908 2 ug
EUR 325

LARGE Recombinant Protein (Human)

RP040651 100 ug Ask for price

LARGE Recombinant Protein (Rat)

RP207821 100 ug Ask for price

LARGE Recombinant Protein (Mouse)

RP146864 100 ug Ask for price

Measuring Spoon (Large Pack)

SPN1 200pack
EUR 479
Description: Individually wrapped 1.2mL spoons. Sterile. Pack of 200.

CytoSelect 24-Well Cell Migration Assay (8 µm, Colorimetric Format), Trial Size

CBA-100-T 4 assays
EUR 299
Description: Chemotaxis describes the movement of cells toward or away from a chemical stimulus in their environment. Cell chemotaxis plays a pivotal role in the progression of cancer and other diseases. CytoSelect Cell Migration Assays are ideal for determining the chemotactic properties of cells. The 8 µm pore size is suitable for most cell types including epithelial cells, fibroblasts, and cancer cell lines.

CytoSelect 24-Well Cell Migration Assay (8 µm, Fluorometric Format), Trial Size

CBA-101-T 4 assays
EUR 299
Description: Chemotaxis describes the movement of cells toward or away from a chemical stimulus in their environment. Cell chemotaxis plays a pivotal role in the progression of cancer and other diseases. CytoSelect Cell Migration Assays are ideal for determining the chemotactic properties of cells. The 8 µm pore size is suitable for most cell types including epithelial cells, fibroblasts, and cancer cell lines.

CytoSelect 24-Well Cell Migration Assay (5 µm, Fluorometric Format), Trial Size

CBA-102-T 4 assays
EUR 299
Description: Chemotaxis describes the movement of cells toward or away from a chemical stimulus in their environment. Cell chemotaxis plays a pivotal role in the progression of cancer and other diseases. CytoSelect Cell Migration Assays are ideal for determining the chemotactic properties of cells. The 5 µm pore size is ideal for monocytes / macrophages.

CytoSelect 24-Well Cell Migration Assay (3 µm, Fluorometric Format), Trial Size

CBA-103-T 4 assays
EUR 299
Description: Chemotaxis describes the movement of cells toward or away from a chemical stimulus in their environment. Cell chemotaxis plays a pivotal role in the progression of cancer and other diseases. CytoSelect Cell Migration Assays are ideal for determining the chemotactic properties of cells. The 3 µm pore size is best for the smallest cells including neutrophils and other leukocytes.

CytoSelect 24-Well Cell Invasion Assay (Basement Membrane, Colorimetric Format), Trial Size

CBA-110-T 4 assays
EUR 322
Description: The ability of malignant tumor cells to invade normal surrounding tissue contributes in large part to the morbidity and mortality of cancers. Cell invasion requires several distinct cellular functions including adhesion, motility, detachment, and extracellular matrix proteolysis. Our CytoSelect Cell Invasion Assays utilize precoated inserts to assay the invasive properties of tumor cells. Invasive cells can be quantified in 24-well plates on either a standard microplate reader or a fluorescence plate reader. Inserts are precoated on the top of the membrane with ECM matrix gel (basement membrane), a protein mix isolated from EHS tumor cells.

CytoSelect 24-Well Cell Invasion Assay (Basement Membrane, Fluorometric Format), Trial Size

CBA-111-T 4 assays
EUR 322
Description: The ability of malignant tumor cells to invade normal surrounding tissue contributes in large part to the morbidity and mortality of cancers. Cell invasion requires several distinct cellular functions including adhesion, motility, detachment, and extracellular matrix proteolysis. Our CytoSelect Cell Invasion Assays utilize precoated inserts to assay the invasive properties of tumor cells. Invasive cells can be quantified in 24-well plates on either a standard microplate reader or a fluorescence plate reader. Inserts are precoated on the top of the membrane with ECM matrix gel (basement membrane), a protein mix isolated from EHS tumor cells.

Large T Antigen (LT) Antibody

  • EUR 1233.00
  • EUR 592.00
  • 1 mg
  • 200 ug
  • Please enquire.

Ribosomal Protein, Large, P0 Antibody

  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Human Like Glycosyltransferase (LARGE) Protein

  • EUR 648.00
  • EUR 272.00
  • EUR 1998.00
  • EUR 773.00
  • EUR 467.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Polyclonal Caspase-12 Antibody (Large)

APR06327G 0.1 mg
EUR 659
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human Caspase-12 (Large). This antibody is tested and proven to work in the following applications:

Large T Antigen (LT) Protein

  • EUR 648.00
  • EUR 272.00
  • EUR 1998.00
  • EUR 773.00
  • EUR 467.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Rubisco (Large Chain) Monoclonal Antibody

ABM40217-003ml 0.03ml
EUR 158
  • Immunogen information: Protein
  • Applications tips:
Description: A monoclonal antibody for detection of Rubisco Large Chain) from Plants. This Rubisco Large Chain) antibody is for WB. It is affinity-purified from mouse ascites by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in mouse by using as an immunogen Protein

Rubisco (Large Chain) Monoclonal Antibody

ABM40217-01ml 0.1ml
EUR 289
  • Immunogen information: Protein
  • Applications tips:
Description: A monoclonal antibody for detection of Rubisco Large Chain) from Plants. This Rubisco Large Chain) antibody is for WB. It is affinity-purified from mouse ascites by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in mouse by using as an immunogen Protein

Rubisco (Large Chain) Monoclonal Antibody

ABM40217-02ml 0.2ml
EUR 414
  • Immunogen information: Protein
  • Applications tips:
Description: A monoclonal antibody for detection of Rubisco Large Chain) from Plants. This Rubisco Large Chain) antibody is for WB. It is affinity-purified from mouse ascites by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in mouse by using as an immunogen Protein

Rubisco (Large Chain) Monoclonal Antibody

ABM40218-003ml 0.03ml
EUR 158
  • Immunogen information: Protein
  • Applications tips:
Description: A monoclonal antibody for detection of Rubisco Large Chain) from Plants. This Rubisco Large Chain) antibody is for WB. It is affinity-purified from mouse ascites by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in mouse by using as an immunogen Protein

Rubisco (Large Chain) Monoclonal Antibody

ABM40218-01ml 0.1ml
EUR 289
  • Immunogen information: Protein
  • Applications tips:
Description: A monoclonal antibody for detection of Rubisco Large Chain) from Plants. This Rubisco Large Chain) antibody is for WB. It is affinity-purified from mouse ascites by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in mouse by using as an immunogen Protein

Rubisco (Large Chain) Monoclonal Antibody

ABM40218-02ml 0.2ml
EUR 414
  • Immunogen information: Protein
  • Applications tips:
Description: A monoclonal antibody for detection of Rubisco Large Chain) from Plants. This Rubisco Large Chain) antibody is for WB. It is affinity-purified from mouse ascites by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in mouse by using as an immunogen Protein

SV40 large T antigen NLS

HY-P0310 5mg
EUR 491

Rubisco(Large Chain) Monoclonal Antibody

EM1214-100ul 100ul
EUR 279
Description: A Mouse Monoclonal antibody against Rubisco(Large Chain) from Plants. This antibody is tested and validated for WB, ELISA

Rubisco(Large Chain) Monoclonal Antibody

EM1214-50ul 50ul
EUR 207
Description: A Mouse Monoclonal antibody against Rubisco(Large Chain) from Plants. This antibody is tested and validated for WB, ELISA

Large DNA Fragment Extraction Kit

FYG204-100P 100 Preps Ask for price

Large DNA Fragment Extraction Kit

FYG204-300P 300 Preps Ask for price

Bst DNA Polymerase Large Fragment

P701-01 800 U
EUR 122

Bst DNA Polymerase Large Fragment

P701-02 8000 U
EUR 271

Large ORF Vector (Rat) (pORF)

ORF069275 1.0 ug DNA
EUR 506

Bst DNA Polymerase, Large Fragment

EUR 289

Bsu DNA Polymerase Large Fragment

EUR 398

h LARGE inducible lentiviral particles

LVP603 1x107 IFU/ml x 200ul
EUR 451
Description: Pre-made over-expression lentivirus for expressing human target: LARGE (like-glycosyltransferase (LARGE)), [alternative names: MDC1D; MDDGA6; MDDGB6]. The sub-cloned codon sequence is identical (100% match) to CDS region in NCBI ID: NM_133642.3. It also contains a RFP-Blasticidin dual selection marker.

LARGE ORF Vector (Human) (pORF)

ORF013551 1.0 ug DNA
EUR 354

Large ORF Vector (Mouse) (pORF)

ORF048956 1.0 ug DNA
EUR 506

Anti-LARGE (aa421-433) antibody

STJ72207 100 µg
EUR 359

Anti-LARGE (N-terminus) antibody

STJ72208 100 µg
EUR 260

Anti-Rubisco (Large Chain) antibody

STJ97527 200 µl
EUR 197
Description: Mouse monoclonal to Rubisco (Large Chain) (3G7).

Anti-Rubisco (Large Chain) antibody

STJ97528 200 µl
EUR 197
Description: Mouse monoclonal to Rubisco (Large Chain) (1H1).

Recombinant MeV Large Polymerase Protein

VAng-Lsx0385-inquire inquire Ask for price
Description: Recombinant MeV Large Polymerase containing the large polymerase immunodominant regions, 58-149 amino acids was expressed in E. coli and purified by proprietary chromatographic technique.

Scoops Material Stainless Steel, Large

SP076 1 UNIT
EUR 57.4
  • Product category: Labware/Lab Accessories/Scoops

96-Well Cellular Senescence Assay Kit (SA-?-gal Activity, Fluorometric Format), Trial Size

CBA-231-T 24 assays
EUR 345
Description: Our Cellular Senescence Activity Assay provides an efficient method to measure Senescence Associated (SA) ß-galactosidase activity. SA-ß-Gal catalyzes the hydrolysis of X-gal, which produces a blue color in senescent cells. Quantify senescence using a fluorescence plate reader.

50 kb large-Range DNA ladder

308-025 250 µg
EUR 120

STAT Universal Animal IHC KIT-large

329ANK-60 Large Kit
EUR 1088

Rubisco Mouse Polyclonal Antibody(Large Chain)

38084-100ul 100ul
EUR 252

Rubisco Mouse Polyclonal Antibody(Large Chain)

38084-50ul 50ul
EUR 187

Rubisco (Large Chain) Monoclonal Antibody(3G7)

44091-100ul 100ul
EUR 252

Rubisco (Large Chain) Monoclonal Antibody(1H1)

44092-100ul 100ul
EUR 252

Rat Disks large homolog 3 (Dlg3)

  • EUR 505.00
  • EUR 265.00
  • EUR 1827.00
  • EUR 766.00
  • EUR 1218.00
  • EUR 335.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 120.5 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Rat Disks large homolog 3(Dlg3) expressed in E.coli

Rubisco Mouse Polyclonal Antibody(Large Chain)

EUR 335
  • Form: Liquid
  • Buffer: pH 7.4 150mM NaCl 0.02% sodium azide and 50% Antigen Affinity Purified
Description: A polyclonal antibody against Rubisco Mouse Polyclonal(Large Chain). Recognizes Rubisco Mouse Polyclonal(Large Chain) from Various Plants. This antibody is Unconjugated. Tested in the following application: WB;WB:1:2000-5000

Rubisco Mouse Polyclonal Antibody(Large Chain)

CSB-PA060093-100ul 100ul
EUR 316
  • Form: Liquid
  • Buffer: pH 7.4 150mM NaCl 0.02% sodium azide and 50% Antigen Affinity Purified
Description: A polyclonal antibody against Rubisco Mouse Polyclonal(Large Chain). Recognizes Rubisco Mouse Polyclonal(Large Chain) from Various Plants. This antibody is Unconjugated. Tested in the following application: WB;WB:1:2000-5000

Active Calpain 1, Large Subunit (CAPN1)

  • EUR 749.60
  • EUR 304.00
  • EUR 2536.00
  • EUR 912.00
  • EUR 1724.00
  • EUR 565.00
  • EUR 6190.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P97571
  • Buffer composition: 20mM Tris, 150mM NaCl, pH8.0, containing 1mM EDTA, 1mM DTT, 0.01% SKL, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 33.5kDa
  • Isoelectric Point: 5.3
Description: Recombinant Rat Calpain 1, Large Subunit expressed in: E.coli

Active Calpain 1, Large Subunit (CAPN1)

  • EUR 749.60
  • EUR 304.00
  • EUR 2536.00
  • EUR 912.00
  • EUR 1724.00
  • EUR 565.00
  • EUR 6190.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P97571
  • Buffer composition: 20mM Tris, 150mM NaCl, pH8.0, containing 1mM EDTA, 1mM DTT, 0.01% SKL, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 37.2kDa
  • Isoelectric Point: 5.9
Description: Recombinant Rat Calpain 1, Large Subunit expressed in: E.coli

Rubisco (Large Chain) Monoclonal Antibody (9Y6)

A01110-005ml 0.05ml
EUR 147
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:2000-1:5000). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adjusted and
  • Show more
Description: A monoclonal antibody for detection of Rubisco Large Chain) from Plants. This Rubisco Large Chain) antibody is for WB. It is affinity-purified from mouse ascites by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in mouse by using as an immunogen recombinant protein

Rubisco (Large Chain) Monoclonal Antibody (9Y6)

A01110-02ml 0.2ml
EUR 332
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:2000-1:5000). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adjusted and
  • Show more
Description: A monoclonal antibody for detection of Rubisco Large Chain) from Plants. This Rubisco Large Chain) antibody is for WB. It is affinity-purified from mouse ascites by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in mouse by using as an immunogen recombinant protein

Rubisco (Large Chain) Monoclonal Antibody (9Y6)

A01110-02ml5 0.2ml×5
EUR 920
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:2000-1:5000). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adjusted and
  • Show more
Description: A monoclonal antibody for detection of Rubisco Large Chain) from Plants. This Rubisco Large Chain) antibody is for WB. It is affinity-purified from mouse ascites by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in mouse by using as an immunogen recombinant protein

Rubisco (Large Chain) Monoclonal Antibody (9Y6)

A01110HRP-005ml 0.05ml
EUR 180
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:2000-1:5000). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adjusted and
  • Show more
Description: A monoclonal antibody for detection of Rubisco Large Chain) from Plants. This Rubisco Large Chain) antibody is for WB. It is affinity-purified from mouse ascites by affinity-chromatography using the specific immunogen and conjugated to HRP. The antibody is produced in mouse by using as an immunogen recombinant protein

Rubisco (Large Chain) Monoclonal Antibody (9Y6)

A01110HRP-02ml 0.2ml
EUR 398
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:2000-1:5000). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adjusted and
  • Show more
Description: A monoclonal antibody for detection of Rubisco Large Chain) from Plants. This Rubisco Large Chain) antibody is for WB. It is affinity-purified from mouse ascites by affinity-chromatography using the specific immunogen and conjugated to HRP. The antibody is produced in mouse by using as an immunogen recombinant protein

Rubisco (Large Chain) Monoclonal Antibody (9Y6)

A01110HRP-02ml5 0.2ml×5
EUR 1265
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:2000-1:5000). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adjusted and
  • Show more
Description: A monoclonal antibody for detection of Rubisco Large Chain) from Plants. This Rubisco Large Chain) antibody is for WB. It is affinity-purified from mouse ascites by affinity-chromatography using the specific immunogen and conjugated to HRP. The antibody is produced in mouse by using as an immunogen recombinant protein

Discs Large Homolog 4 (DLG4) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Discs Large Homolog 4 (DLG4) Antibody

  • EUR 495.00
  • EUR 356.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Discs, Large Homolog 4 (DLG4) Antibody

  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Calpain 2, Large Subunit (CAPN2) Antibody

  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Calpain 2, Large Subunit (CAPN2) Antibody

  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Discs, Large Homolog 4 (DLG4) Antibody

  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Discs, Large Homolog 4 (DLG4) Antibody

  • EUR 439.00
  • EUR 133.00
  • EUR 1233.00
  • EUR 592.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Discs, Large Homolog 4 (DLG4) Antibody

  • EUR 1233.00
  • EUR 592.00
  • 1 mg
  • 200 ug
  • Please enquire.

Discs, Large Homolog 4 (DLG4) Antibody

  • EUR 453.00
  • EUR 133.00
  • EUR 1302.00
  • EUR 620.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.

Large Proline-Rich Protein (BAG6) Antibody

  • EUR 1233.00
  • EUR 592.00
  • 1 mg
  • 200 ug
  • Please enquire.

Large Proline-Rich Protein (BAG6) Antibody

  • EUR 1233.00
  • EUR 592.00
  • 1 mg
  • 200 ug
  • Please enquire.

Large Multifunctional Peptidase 2 (LMP2) Antibody

  • EUR 398.00
  • EUR 133.00
  • EUR 1107.00
  • EUR 537.00
  • EUR 314.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Calpain 1, Large Subunit (CAPN1) Antibody

  • EUR 411.00
  • EUR 133.00
  • EUR 1149.00
  • EUR 565.00
  • EUR 314.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Calpain 1, Large Subunit (CAPN1) Antibody

  • EUR 425.00
  • EUR 133.00
  • EUR 1177.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.

Calpain 1, Large Subunit (CAPN1) Antibody

  • EUR 425.00
  • EUR 133.00
  • EUR 1177.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Calpain 1, Large Subunit (CAPN1) Antibody

  • EUR 439.00
  • EUR 133.00
  • EUR 1247.00
  • EUR 592.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.

Calpain 1, Large Subunit (CAPN1) Antibody

  • EUR 439.00
  • EUR 133.00
  • EUR 1247.00
  • EUR 592.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Large Multifunctional Peptidase 7 (LMP7) Antibody

  • EUR 411.00
  • EUR 133.00
  • EUR 1149.00
  • EUR 565.00
  • EUR 314.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Large Multifunctional Peptidase 7 (LMP7) Antibody

  • EUR 425.00
  • EUR 133.00
  • EUR 1177.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Large Multifunctional Peptidase 7 (LMP7) Antibody

  • EUR 439.00
  • EUR 133.00
  • EUR 1233.00
  • EUR 592.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Calpain 2, Large Subunit (CAPN2) Antibody

  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Calpain 2, Large Subunit (CAPN2) Antibody

  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Discs, Large Homolog 3 (DLG3) Antibody

  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Discs, Large Homolog 5 (DLG5) Antibody

  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Disks Large Homolog 1 (DLG1) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Discs Large Homolog 4 (DLG4) Antibody

  • EUR 495.00
  • EUR 704.00
  • EUR 356.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.

Calpain 1, Large Subunit (CAPN1) Antibody

  • EUR 411.00
  • EUR 133.00
  • EUR 1149.00
  • EUR 565.00
  • EUR 314.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Discs, Large Homolog 3 (DLG3) Antibody

  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Large Multifunctional Peptidase 2 (LMP2) Antibody

  • EUR 411.00
  • EUR 133.00
  • EUR 1135.00
  • EUR 551.00
  • EUR 314.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Discs, Large Homolog 5 (DLG5) Antibody

  • EUR 439.00
  • EUR 133.00
  • EUR 1233.00
  • EUR 592.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Discs, Large Homolog 5 (DLG5) Antibody

  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Calpain 2, Large Subunit (CAPN2) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Disks Large Homolog 1 (DLG1) Antibody

  • EUR 425.00
  • EUR 342.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Disks Large Homolog 3 (DLG3) Antibody

  • EUR 425.00
  • EUR 342.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Large Multifunctional Peptidase 2 (LMP2) Antibody

  • EUR 787.00
  • EUR 411.00
  • 1 mg
  • 200 ug
  • Please enquire.

Calpain 1, Large Subunit (CAPN1) Antibody

  • EUR 815.00
  • EUR 425.00
  • 1 mg
  • 200 ug
  • Please enquire.

Calpain 1, Large Subunit (CAPN1) Antibody

  • EUR 871.00
  • EUR 453.00
  • 1 mg
  • 200 ug
  • Please enquire.

KRAS/GNAS-testing was considerably superior to CEA (P = 0,0209) and cytology (P = 0.0016). In conclusion, KRAS/GNAS-testing by deep focused NGS is an acceptable technique to tell apart mucinous from non-mucinous pancreatic lesions, suggesting its utilization as a single diagnostic check. Outcomes have to be confirmed in a bigger cohort. This text is protected by copyright. All rights reserved.