Month: March 2021

A Rapid NGS-Based Preimplantation Genetic Testing for Chromosomal Abnormalities in Day-3 Blastomere Biopsy Allows Embryo Transfer Within the Same Treatment Cycle

A Rapid NGS-Based Preimplantation Genetic Testing for Chromosomal Abnormalities in Day-3 Blastomere Biopsy Allows Embryo Transfer Within the Same Treatment Cycle

These days, many of the preimplantation genetic testing (PGT) is carried out with a method of complete chromosome screening and trophectoderm biopsy. However, sufferers with ovarian insufficiency could not have competent blastocysts. Within the current examine, we aimed to ascertain the worth of a number of annealing and looping-based amplification cycle (MALBAC)-based next-generation sequencing (NGS) for PGT in day-Three embryos. A complete of 94.3% (1168/1239) of embryos yielded informative outcomes, and the general embryo euploid charge was 21.9% (256/1168).

Total, 225 embryos have been transferred in 169 cycles with a medical being pregnant charge of 49.1% (83/169). The stay start and implantation charges have been 47.3% (80/169) and 44.4% (100/225), respectively. Double embryos switch confirmed greater medical being pregnant and stay start charges in contrast with single embryo switch, however the implantation charges have been comparable (44.2% vs. 44.6%, P > 0.05). The euploid charge for reciprocal translocations (16.1%) was considerably decrease than that for Robertsonian translocations (28.0%, P < 0.01) and inversions (28.0%, P < 0.01). Nonetheless, greater percentages of embryos with de novo abnormalities have been noticed with Robertsonian translocations (23.3%, P < 0.01) and inversions (30.5%, P < 0.01) than with reciprocal translocations (11.6%).

From Sep. 2016 to Aug. 2018, a complete of six {couples} participated on this examine. 4 instances carried DMD exon deletions and two carried exon duplications. Trophectoderm cells have been biopsied at day 5 or 6 and NGS was used within the genetic testing of the biopsied cells after whole-genome amplification. We developed a brand new method-DIRected Embryonic Cell Testing of Exon Deletion/Duplication (DIRECTED) to instantly detect the single-gene mutation by NGS. Linage evaluation based mostly on single-nucleotide polymorphism (SNP) was used to validate the outcomes from DIRECTED.

 Within the 4 deletion instances, DIRECTED was used to detect DMD exon deletion in 16 biopsied embryos. All DIRECTED outcomes have been in line with linkage evaluation, indicating this technique was dependable in detecting deletions round 1 Mb. Within the two instances carrying exon duplications, no blastocyst was obtained for biopsy. Nonetheless, preliminary experiment outcomes urged that DIRECTED may be used for direct detection of exon duplications in embryos. We demonstrated that NGS for PGT on day-Three embryos is an efficient medical software, significantly for sufferers with a diminished ovarian reserve and restricted embryos.

Subsequent-Era Sequencing (NGS)-Primarily based Preimplantation Genetic Testing for Aneuploidy (PGT-A) of Trophectoderm Biopsy for Recurrent Implantation Failure (RIF) Sufferers: a Retrospective Research

Recurrent implantation failure (RIF) is an intrigue situation throughout in vitro fertilization (IVF) cycles or intracytoplasmic sperm injection (ICSI) remedies. The aim of this retrospective examine is to discover the worth of next-generation sequencing (NGS)-based preimplantation genetic testing for aneuploidy (PGT-A) of trophectoderm biopsy within the medical outcomes for RIF sufferers with superior age. A complete of 265 RIF sufferers, who underwent 346 oocyte retrieval cycles and 250 PGT-A cycles, have been categorised as two teams in keeping with the feminine age, together with < 38 and ≥ 38 years outdated teams.

The 2 teams have been statistically comparable in baseline traits. The part of aneuploid embryos was considerably greater in superior age group than in youthful age group (68.9 vs 39.9%, P < 0.001). However there have been no statistically vital variations in being pregnant charge (43.5 vs 64.7%), medical being pregnant charge (39.1 vs 48.0%), implantation charge (39.1 vs 51.0%), and miscarriage charge (4.Three vs 7.8%) per embryo switch (ET) between the 2 teams. Outcomes counsel that the embryo-related issue performs an important position in RIF. Maternal age doesn’t affect the implantation potential of euploid blastocysts.

The NGS-based PGT-A involving trophectoderm biopsy is efficacious for RIF sufferers of superior age by enhancing their medical outcomes. In conclusion, the NGS-based PGT-A involving trophectoderm biopsy could symbolize a invaluable complement to the present RIF administration. Nonetheless, these findings ought to be additional validated in a well-designed randomized managed trial.

A Rapid NGS-Based Preimplantation Genetic Testing for Chromosomal Abnormalities in Day-3 Blastomere Biopsy Allows Embryo Transfer Within the Same Treatment Cycle

Sanger sequencing is not all the time needed based mostly on a single-center validation of 1109 NGS variants in 825 medical exomes

Regardless of the improved accuracy of next-generation sequencing (NGS), it’s extensively accepted that variants have to be validated utilizing Sanger sequencing earlier than reporting. Validation of all NGS variants significantly will increase the turnaround time and prices of medical prognosis. We comprehensively assessed this want in 1109 variants from 825 medical exomes, the biggest pattern set up to now assessed utilizing Illumina chemistry reported. With a concordance of 100%, we conclude that Sanger sequencing might be very helpful as an inside high quality management, however not a lot as a verification technique for high-quality single-nucleotide and small insertion/deletions variants.

Laboratories would possibly validate and set up their very own thresholds earlier than discontinuing Sanger affirmation research. We additionally increase and validate 23 copy quantity variations detected by exome sequencing in 20 samples, observing a concordance of 95.65%.  47 sufferers have been enrolled for additional evaluation. A last prognosis was accessible in 27 instances together with Eight adverse controls. In 43/47 (91.5%) of sufferers a KRAS- and/or GNAS-mutation was identified by NGS. 27.0% of the KRAS-mutated and 10.0% of the GNAS-mutated lesions harbored a number of mutations. KRAS/GNAS-testing by NGS, cytology, and CEA had a sensitivity and specificity of 94.7/100%, 38.1/100% and 42.1/75.0%, respectively.

transilluminator led 20x12 cm + hood

BLOOK ea
EUR 580

Accuris™ UV Transilluminator

BM0298 Ea
EUR 1306

PMA-Lite LED Photolysis Device

E90002 1EA
EUR 2211
Description: Minimum order quantity: 1 unit of 1EA

Gel-Bright LED Gel Illuminator

E90003 1EA
EUR 773
Description: Minimum order quantity: 1 unit of 1EA

Glo-Plate Blue LED Illuminator

E90004 1EA
EUR 717
Description: Minimum order quantity: 1 unit of 1EA

uv table blue led 20x20 cm

VLECX-20BLUE ea
EUR 1535

Accuris™ UV Transilluminator, 230V input

BM0299 Ea
EUR 1306

WUV-M20, UV Transilluminator, 312nm, 100V

3532197 1unit
EUR 1627

WUV-M20, UV Transilluminator, 312nm, 220V

3532198 1unit
EUR 1627

Sealing Mats for 96 Well Format

GP501 5 mats
EUR 147

uv transilluminator 20x20cm, 312nm, 50/100% switch

UVTR2200 ea
EUR 1161

Pressure Sealing Mats for 384 Well Format

GP504 5 mats
EUR 196

PGE2 Multi-Format EIA kit (One Plate)

K051-H1 1x96 well plate
EUR 379

PGE2 Multi-Format EIA kit (Five Plate)

K051-H5 5x96 well plate
EUR 1344

LARGE siRNA

20-abx922269
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

LARGE siRNA

20-abx922270
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

LARGE antibody

70R-6856 50 ug
EUR 467
Description: Rabbit polyclonal LARGE antibody raised against the middle region of LARGE

CytoSelect 96-Well Phagocytosis Assay (E. coli, Colorimetric Format)

CBA-222 96 assays
EUR 693
Description: Phagocytosis can be assayed by measuring the engulfment of a cell "substrate". However, traditional assays require tedious cell counting under a microscope. Our CytoSelect 96-Well Phagocytosis Assay, E. coli Substrate provides a more accurate, user-friendly, high-throughput alternative to the standard phagocytosis assay. The assay may be adapted for use with 24-well or 48-well plates.

LARGE ELISA Kit| chicken Glycosyltransferase-like protein LARGE

EF012373 96 Tests
EUR 689

Large-CRP OmcBProtein

20-abx600013
  • EUR 843.00
  • EUR 439.00
  • EUR 1274.00
  • EUR 1636.00
  • EUR 551.00
  • 100 ug
  • 10 ug
  • 200 ug
  • 500 ug
  • 50 ug
  • Shipped within 1 month.

Large-CRP OmcBProtein

20-abx600014
  • EUR 2764.00
  • EUR 1734.00
  • 100 ug
  • 50 ug
  • Shipped within 3 months.

LARGE cloning plasmid

CSB-CL012749HU-10ug 10ug
EUR 745
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2271
  • Sequence: atgctgggaatctgcagggggagacggaaattcttggctgcctcgttgagtcttctctgcatcccagccatcacctggatttacctgttttctgggagcttcgaagatggaaagcccgtgtctctgtcaccgctggagtcccaggcacacagccccaggtacacggcctccagcc
  • Show more
Description: A cloning plasmid for the LARGE gene.

anti- LARGE antibody

FNab04697 100µg
EUR 548.75
  • Immunogen: like-glycosyltransferase
  • Uniprot ID: O95461
  • Gene ID: 9215
  • Research Area: Metabolism
Description: Antibody raised against LARGE

LARGE Rabbit pAb

A19515-100ul 100 ul Ask for price

LARGE Rabbit pAb

A19515-200ul 200 ul Ask for price

LARGE Rabbit pAb

A19515-20ul 20 ul Ask for price

LARGE Rabbit pAb

A19515-50ul 50 ul
EUR 308

LARGE Blocking Peptide

33R-1247 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of CRYM antibody, catalog no. 70R-1992

Anti-LARGE antibody

PAab04697 100 ug
EUR 386

Anti-LARGE antibody

STJ11100708 50 µl
EUR 287
Description: This gene, which is one of the largest in the human genome, encodes a member of the N-acetylglucosaminyltransferase gene family. It encodes a glycosyltransferase which participates in glycosylation of alpha-dystroglycan, and may carry out the synthesis of glycoprotein and glycosphingolipid sugar chains. It may also be involved in the addition of a repeated disaccharide unit. Mutations in this gene cause MDC1D, a novel form of congenital muscular dystrophy with severe mental retardation and abnormal glycosylation of alpha-dystroglycan. Alternative splicing of this gene results in two transcript variants that encode the same protein.

Spatulas (Large Pack)

SPAT1 50pack
EUR 301
Description: Individually wrapped spatulas. RNase/DNase free, non-pyrogenic, antistatic, sterile, plastic. Pack of 50.

Retinol Binding Protein (RBP) Multi-format EIA Kit (One Plate)

K062-H1 1x96 well plate
EUR 369

Retinol Binding Protein (RBP) Multi-format EIA Kit (Five Plate)

K062-H5 5x96 well plate
EUR 1344

Large-CRP OmcB Protein

20-abx600002
  • EUR 1970.00
  • EUR 3919.00
  • EUR 2541.00
  • EUR 1414.00
  • 100 ug
  • 1 mg
  • 500 ug
  • 50 ug
  • Shipped within 3 months.

Large-CRP OmcB Protein

20-abx600012
  • EUR 2486.00
  • EUR 1455.00
  • EUR 1622.00
  • EUR 1107.00
  • 1 mg
  • 200 ug
  • 500 ug
  • 50 ug
  • Shipped within 3 months.

Chicken LARGE ELISA KIT

ELI-08774c 96 Tests
EUR 928

LARGE ELISA KIT|Human

EF010620 96 Tests
EUR 689

Like Glycosyltransferase (LARGE) Antibody

20-abx124463
  • EUR 411.00
  • EUR 592.00
  • 100 ul
  • 200 ul
  • Shipped within 5-10 working days.

Like Glycosyltransferase (LARGE) Antibody

20-abx128114
  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Rubisco (Large Chain) Antibody

20-abx159680
  • EUR 272.00
  • EUR 230.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Rubisco (Large Chain) Antibody

20-abx159681
  • EUR 272.00
  • EUR 230.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Rubisco Large Chain Antibody

20-abx134717
  • EUR 356.00
  • EUR 537.00
  • EUR 217.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

Rubisco Antibody (Large Chain)

abx332842-100ul 100 ul
EUR 425
  • Shipped within 5-10 working days.

Like Glycosyltransferase (LARGE) Antibody

abx432911-200ul 200 ul
EUR 384
  • Shipped within 1-3 working days.

Like Glycosyltransferase (LARGE) Antibody

abx432912-200ul 200 ul
EUR 286
  • Shipped within 1-3 working days.

Like Glycosyltransferase (LARGE) Antibody

abx234697-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

Human LARGE shRNA Plasmid

20-abx956100
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Caspase-12 Antibody (Large)

24208-100ul 100ul
EUR 390

Mouse LARGE shRNA Plasmid

20-abx971279
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Recombinant Like Glycosyltransferase (LARGE)

4-RPH936Hu01
  • EUR 467.36
  • EUR 228.00
  • EUR 1477.60
  • EUR 559.20
  • EUR 1018.40
  • EUR 376.00
  • EUR 3544.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: O95461
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 47.0kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human Like Glycosyltransferase expressed in: E.coli

LARGE Recombinant Protein (Human)

RP040651 100 ug Ask for price

pSG5 Large T Plasmid

PVT15908 2 ug
EUR 325

LARGE Recombinant Protein (Rat)

RP207821 100 ug Ask for price

LARGE Recombinant Protein (Mouse)

RP146864 100 ug Ask for price

Measuring Spoon (Large Pack)

SPN1 200pack
EUR 479
Description: Individually wrapped 1.2mL spoons. Sterile. Pack of 200.

CytoSelect 24-Well Cell Migration Assay (8 µm, Colorimetric Format), Trial Size

CBA-100-T 4 assays
EUR 299
Description: Chemotaxis describes the movement of cells toward or away from a chemical stimulus in their environment. Cell chemotaxis plays a pivotal role in the progression of cancer and other diseases. CytoSelect Cell Migration Assays are ideal for determining the chemotactic properties of cells. The 8 µm pore size is suitable for most cell types including epithelial cells, fibroblasts, and cancer cell lines.

CytoSelect 24-Well Cell Migration Assay (8 µm, Fluorometric Format), Trial Size

CBA-101-T 4 assays
EUR 299
Description: Chemotaxis describes the movement of cells toward or away from a chemical stimulus in their environment. Cell chemotaxis plays a pivotal role in the progression of cancer and other diseases. CytoSelect Cell Migration Assays are ideal for determining the chemotactic properties of cells. The 8 µm pore size is suitable for most cell types including epithelial cells, fibroblasts, and cancer cell lines.

CytoSelect 24-Well Cell Migration Assay (5 µm, Fluorometric Format), Trial Size

CBA-102-T 4 assays
EUR 299
Description: Chemotaxis describes the movement of cells toward or away from a chemical stimulus in their environment. Cell chemotaxis plays a pivotal role in the progression of cancer and other diseases. CytoSelect Cell Migration Assays are ideal for determining the chemotactic properties of cells. The 5 µm pore size is ideal for monocytes / macrophages.

CytoSelect 24-Well Cell Migration Assay (3 µm, Fluorometric Format), Trial Size

CBA-103-T 4 assays
EUR 299
Description: Chemotaxis describes the movement of cells toward or away from a chemical stimulus in their environment. Cell chemotaxis plays a pivotal role in the progression of cancer and other diseases. CytoSelect Cell Migration Assays are ideal for determining the chemotactic properties of cells. The 3 µm pore size is best for the smallest cells including neutrophils and other leukocytes.

CytoSelect 24-Well Cell Invasion Assay (Basement Membrane, Colorimetric Format), Trial Size

CBA-110-T 4 assays
EUR 322
Description: The ability of malignant tumor cells to invade normal surrounding tissue contributes in large part to the morbidity and mortality of cancers. Cell invasion requires several distinct cellular functions including adhesion, motility, detachment, and extracellular matrix proteolysis. Our CytoSelect Cell Invasion Assays utilize precoated inserts to assay the invasive properties of tumor cells. Invasive cells can be quantified in 24-well plates on either a standard microplate reader or a fluorescence plate reader. Inserts are precoated on the top of the membrane with ECM matrix gel (basement membrane), a protein mix isolated from EHS tumor cells.

CytoSelect 24-Well Cell Invasion Assay (Basement Membrane, Fluorometric Format), Trial Size

CBA-111-T 4 assays
EUR 322
Description: The ability of malignant tumor cells to invade normal surrounding tissue contributes in large part to the morbidity and mortality of cancers. Cell invasion requires several distinct cellular functions including adhesion, motility, detachment, and extracellular matrix proteolysis. Our CytoSelect Cell Invasion Assays utilize precoated inserts to assay the invasive properties of tumor cells. Invasive cells can be quantified in 24-well plates on either a standard microplate reader or a fluorescence plate reader. Inserts are precoated on the top of the membrane with ECM matrix gel (basement membrane), a protein mix isolated from EHS tumor cells.

Large T Antigen (LT) Protein

20-abx654150
  • EUR 648.00
  • EUR 272.00
  • EUR 1998.00
  • EUR 773.00
  • EUR 467.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Polyclonal Caspase-12 Antibody (Large)

APR06327G 0.1 mg
EUR 659
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human Caspase-12 (Large). This antibody is tested and proven to work in the following applications:

Large DNA Fragment Extraction Kit

FYG204-100P 100 Preps Ask for price

Large DNA Fragment Extraction Kit

FYG204-300P 300 Preps Ask for price

SV40 large T antigen NLS

HY-P0310 5mg
EUR 491

Rubisco(Large Chain) Monoclonal Antibody

EM1214-100ul 100ul
EUR 279
Description: A Mouse Monoclonal antibody against Rubisco(Large Chain) from Plants. This antibody is tested and validated for WB, ELISA

Rubisco(Large Chain) Monoclonal Antibody

EM1214-50ul 50ul
EUR 207
Description: A Mouse Monoclonal antibody against Rubisco(Large Chain) from Plants. This antibody is tested and validated for WB, ELISA

Ribosomal Protein, Large, P0 Antibody

20-abx115279
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Human Like Glycosyltransferase (LARGE) Protein

20-abx166585
  • EUR 648.00
  • EUR 272.00
  • EUR 1998.00
  • EUR 773.00
  • EUR 467.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Rubisco (Large Chain) Monoclonal Antibody

ABM40217-003ml 0.03ml
EUR 158
  • Immunogen information: Protein
  • Applications tips:
Description: A monoclonal antibody for detection of Rubisco Large Chain) from Plants. This Rubisco Large Chain) antibody is for WB. It is affinity-purified from mouse ascites by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in mouse by using as an immunogen Protein

Rubisco (Large Chain) Monoclonal Antibody

ABM40217-01ml 0.1ml
EUR 289
  • Immunogen information: Protein
  • Applications tips:
Description: A monoclonal antibody for detection of Rubisco Large Chain) from Plants. This Rubisco Large Chain) antibody is for WB. It is affinity-purified from mouse ascites by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in mouse by using as an immunogen Protein

Rubisco (Large Chain) Monoclonal Antibody

ABM40217-02ml 0.2ml
EUR 414
  • Immunogen information: Protein
  • Applications tips:
Description: A monoclonal antibody for detection of Rubisco Large Chain) from Plants. This Rubisco Large Chain) antibody is for WB. It is affinity-purified from mouse ascites by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in mouse by using as an immunogen Protein

Rubisco (Large Chain) Monoclonal Antibody

ABM40218-003ml 0.03ml
EUR 158
  • Immunogen information: Protein
  • Applications tips:
Description: A monoclonal antibody for detection of Rubisco Large Chain) from Plants. This Rubisco Large Chain) antibody is for WB. It is affinity-purified from mouse ascites by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in mouse by using as an immunogen Protein

Rubisco (Large Chain) Monoclonal Antibody

ABM40218-01ml 0.1ml
EUR 289
  • Immunogen information: Protein
  • Applications tips:
Description: A monoclonal antibody for detection of Rubisco Large Chain) from Plants. This Rubisco Large Chain) antibody is for WB. It is affinity-purified from mouse ascites by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in mouse by using as an immunogen Protein

Rubisco (Large Chain) Monoclonal Antibody

ABM40218-02ml 0.2ml
EUR 414
  • Immunogen information: Protein
  • Applications tips:
Description: A monoclonal antibody for detection of Rubisco Large Chain) from Plants. This Rubisco Large Chain) antibody is for WB. It is affinity-purified from mouse ascites by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in mouse by using as an immunogen Protein

Large T Antigen (LT) Antibody

20-abx177313
  • EUR 1233.00
  • EUR 592.00
  • 1 mg
  • 200 ug
  • Please enquire.

Large ORF Vector (Rat) (pORF)

ORF069275 1.0 ug DNA
EUR 506

Bst DNA Polymerase, Large Fragment

M1213-200
EUR 289

Bsu DNA Polymerase Large Fragment

M1214-200
EUR 398

h LARGE inducible lentiviral particles

LVP603 1x107 IFU/ml x 200ul
EUR 451
Description: Pre-made over-expression lentivirus for expressing human target: LARGE (like-glycosyltransferase (LARGE)), [alternative names: MDC1D; MDDGA6; MDDGB6]. The sub-cloned codon sequence is identical (100% match) to CDS region in NCBI ID: NM_133642.3. It also contains a RFP-Blasticidin dual selection marker.

Large ORF Vector (Mouse) (pORF)

ORF048956 1.0 ug DNA
EUR 506

LARGE ORF Vector (Human) (pORF)

ORF013551 1.0 ug DNA
EUR 354

Bst DNA Polymerase Large Fragment

P701-01 800 U
EUR 122

Bst DNA Polymerase Large Fragment

P701-02 8000 U
EUR 271

Anti-LARGE (aa421-433) antibody

STJ72207 100 µg
EUR 359

Anti-LARGE (N-terminus) antibody

STJ72208 100 µg
EUR 260

Anti-Rubisco (Large Chain) antibody

STJ97527 200 µl
EUR 197
Description: Mouse monoclonal to Rubisco (Large Chain) (3G7).

Anti-Rubisco (Large Chain) antibody

STJ97528 200 µl
EUR 197
Description: Mouse monoclonal to Rubisco (Large Chain) (1H1).

Recombinant MeV Large Polymerase Protein

VAng-Lsx0385-inquire inquire Ask for price
Description: Recombinant MeV Large Polymerase containing the large polymerase immunodominant regions, 58-149 amino acids was expressed in E. coli and purified by proprietary chromatographic technique.

Scoops Material Stainless Steel, Large

SP076 1 UNIT
EUR 57.4
  • Product category: Labware/Lab Accessories/Scoops

96-Well Cellular Senescence Assay Kit (SA-?-gal Activity, Fluorometric Format), Trial Size

CBA-231-T 24 assays
EUR 345
Description: Our Cellular Senescence Activity Assay provides an efficient method to measure Senescence Associated (SA) ß-galactosidase activity. SA-ß-Gal catalyzes the hydrolysis of X-gal, which produces a blue color in senescent cells. Quantify senescence using a fluorescence plate reader.

Active Calpain 1, Large Subunit (CAPN1)

4-APB964Ra01
  • EUR 749.60
  • EUR 304.00
  • EUR 2536.00
  • EUR 912.00
  • EUR 1724.00
  • EUR 565.00
  • EUR 6190.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P97571
  • Buffer composition: 20mM Tris, 150mM NaCl, pH8.0, containing 1mM EDTA, 1mM DTT, 0.01% SKL, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 33.5kDa
  • Isoelectric Point: 5.3
Description: Recombinant Rat Calpain 1, Large Subunit expressed in: E.coli

Active Calpain 1, Large Subunit (CAPN1)

4-APB964Ra02
  • EUR 749.60
  • EUR 304.00
  • EUR 2536.00
  • EUR 912.00
  • EUR 1724.00
  • EUR 565.00
  • EUR 6190.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P97571
  • Buffer composition: 20mM Tris, 150mM NaCl, pH8.0, containing 1mM EDTA, 1mM DTT, 0.01% SKL, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 37.2kDa
  • Isoelectric Point: 5.9
Description: Recombinant Rat Calpain 1, Large Subunit expressed in: E.coli

Human Large Intestine Microvascular Endothelial Cells

HEC16 500,000+ Cells Frozen
EUR 1080

Disks Large Homolog 1 (DLG1) Antibody

20-abx124281
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Discs Large Homolog 4 (DLG4) Antibody

20-abx125325
  • EUR 495.00
  • EUR 704.00
  • EUR 356.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.

Calpain 2, Large Subunit (CAPN2) Antibody

20-abx111330
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Discs, Large Homolog 3 (DLG3) Antibody

20-abx112100
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Discs, Large Homolog 5 (DLG5) Antibody

20-abx112101
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Calpain 1, Large Subunit (CAPN1) Antibody

20-abx128598
  • EUR 411.00
  • EUR 133.00
  • EUR 1149.00
  • EUR 565.00
  • EUR 314.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Discs, Large Homolog 3 (DLG3) Antibody

20-abx129226
  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Large Multifunctional Peptidase 2 (LMP2) Antibody

20-abx129728
  • EUR 411.00
  • EUR 133.00
  • EUR 1135.00
  • EUR 551.00
  • EUR 314.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Discs, Large Homolog 5 (DLG5) Antibody

20-abx131277
  • EUR 439.00
  • EUR 133.00
  • EUR 1233.00
  • EUR 592.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Discs, Large Homolog 5 (DLG5) Antibody

20-abx131278
  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Calpain 2, Large Subunit (CAPN2) Antibody

20-abx109593
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Disks Large Homolog 1 (DLG1) Antibody

20-abx149846
  • EUR 425.00
  • EUR 342.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Disks Large Homolog 3 (DLG3) Antibody

20-abx149847
  • EUR 425.00
  • EUR 342.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Calpain 1, Large Subunit (CAPN1) Antibody

20-abx102521
  • EUR 411.00
  • EUR 133.00
  • EUR 1149.00
  • EUR 565.00
  • EUR 314.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Calpain 1, Large Subunit (CAPN1) Antibody

20-abx102522
  • EUR 425.00
  • EUR 133.00
  • EUR 1177.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.

Calpain 1, Large Subunit (CAPN1) Antibody

20-abx102523
  • EUR 425.00
  • EUR 133.00
  • EUR 1177.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Calpain 1, Large Subunit (CAPN1) Antibody

20-abx102524
  • EUR 439.00
  • EUR 133.00
  • EUR 1247.00
  • EUR 592.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.

Calpain 1, Large Subunit (CAPN1) Antibody

20-abx102525
  • EUR 439.00
  • EUR 133.00
  • EUR 1247.00
  • EUR 592.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Large Multifunctional Peptidase 7 (LMP7) Antibody

20-abx103454
  • EUR 411.00
  • EUR 133.00
  • EUR 1149.00
  • EUR 565.00
  • EUR 314.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Large Multifunctional Peptidase 7 (LMP7) Antibody

20-abx103455
  • EUR 425.00
  • EUR 133.00
  • EUR 1177.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Large Multifunctional Peptidase 7 (LMP7) Antibody

20-abx103456
  • EUR 439.00
  • EUR 133.00
  • EUR 1233.00
  • EUR 592.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Calpain 2, Large Subunit (CAPN2) Antibody

20-abx104994
  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Discs Large Homolog 4 (DLG4) Antibody

20-abx007353
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Discs Large Homolog 4 (DLG4) Antibody

20-abx004732
  • EUR 495.00
  • EUR 356.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Discs, Large Homolog 3 (DLG3) Antibody

20-abx172137
  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.

Discs, Large Homolog 4 (DLG4) Antibody

20-abx172138
  • EUR 913.00
  • EUR 467.00
  • 1 mg
  • 200 ug
  • Please enquire.

Large Multifunctional Peptidase 2 (LMP2) Antibody

20-abx173310
  • EUR 787.00
  • EUR 411.00
  • 1 mg
  • 200 ug
  • Please enquire.

Discs, Large Homolog 4 (DLG4) Antibody

20-abx176180
  • EUR 439.00
  • EUR 133.00
  • EUR 1233.00
  • EUR 592.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Discs, Large Homolog 4 (DLG4) Antibody

20-abx176181
  • EUR 1233.00
  • EUR 592.00
  • 1 mg
  • 200 ug
  • Please enquire.

Discs, Large Homolog 4 (DLG4) Antibody

20-abx176182
  • EUR 453.00
  • EUR 133.00
  • EUR 1302.00
  • EUR 620.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.

Large Proline-Rich Protein (BAG6) Antibody

20-abx176872
  • EUR 1233.00
  • EUR 592.00
  • 1 mg
  • 200 ug
  • Please enquire.

Large Proline-Rich Protein (BAG6) Antibody

20-abx176873
  • EUR 1233.00
  • EUR 592.00
  • 1 mg
  • 200 ug
  • Please enquire.

Large Multifunctional Peptidase 2 (LMP2) Antibody

20-abx177311
  • EUR 398.00
  • EUR 133.00
  • EUR 1107.00
  • EUR 537.00
  • EUR 314.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Large-Conductance Mechanosensitive Channel (mscL) Antibody

20-abx300814
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Large Multifunctional Peptidase 2 (LMP2) Antibody

20-abx319932
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Calpain 2, Large Subunit (CAPN2) Antibody

20-abx326567
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Discs, Large Homolog 4 (DLG4) Antibody

20-abx327113
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Discs, Large Homolog 4 (DLG4) Antibody

20-abx214479
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Calpain 2, Large Subunit (CAPN2) Antibody

20-abx214702
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Calpain 2, Large Subunit (CAPN2) Antibody

20-abx214703
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Discs, Large Homolog 4 (DLG4) Antibody

20-abx214930
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Disks Large Homolog 2 (DLG2) Antibody

20-abx338845
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Disks Large Homolog 1 (DLG1) Antibody

20-abx317333
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Disks Large Homolog 1 (DLG1) Antibody

abx432611-200ul 200 ul
EUR 384
  • Shipped within 1-3 working days.

Discs Large Homolog 4 (DLG4) Antibody

abx430064-200ul 200 ul
EUR 384
  • Shipped within 1-3 working days.

Large Multifunctional Peptidase 2 (LMP2) Antibody

abx234810-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

Disks Large Homolog 1 (DLG1) Antibody

abx232409-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

Disks Large Homolog 3 (DLG3) Antibody

abx232410-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

Disks Large Homolog 5 (DLG5) Antibody

abx232411-100ug 100 ug
EUR 551
  • Shipped within 5-12 working days.

Calpain 1, Large Subunit (CAPN1) Antibody

20-abx171526
  • EUR 815.00
  • EUR 425.00
  • 1 mg
  • 200 ug
  • Please enquire.

Calpain 1, Large Subunit (CAPN1) Antibody

20-abx171527
  • EUR 871.00
  • EUR 453.00
  • 1 mg
  • 200 ug
  • Please enquire.

KRAS/GNAS-testing was considerably superior to CEA (P = 0,0209) and cytology (P = 0.0016). In conclusion, KRAS/GNAS-testing by deep focused NGS is an acceptable technique to tell apart mucinous from non-mucinous pancreatic lesions, suggesting its utilization as a single diagnostic check. Outcomes have to be confirmed in a bigger cohort. This text is protected by copyright. All rights reserved.

IHC versus FISH versus NGS to detect ALK gene rearrangement in NSCLC: all questions answered?

IHC versus FISH versus NGS to detect ALK gene rearrangement in NSCLC: all questions answered?

Anaplastic lymphoma kinase (ALK) rearranged non-small cell lung carcinoma (NSCLC) is a definite molecular subtype and speedy approval of ALK tyrosine kinase inhibitors (TKIs) has necessitated speedy and delicate diagnostic modalities for the detection of this alteration. Gene rearrangements might be recognized utilizing many strategies together with fluorescence in situ hybridisation (FISH), reverse transcriptase-PCR, next-generation sequencing (NGS) and immunohistochemistry (IHC) for fusion oncoprotein expression. We aimed to find out the concordance between IHC, FISH and NGS for ALK biomarker detection, and decide variations in sensitivity, and survival outcomes.
We analysed the concordance between IHC utilizing D5F3 monoclonal antibody, FISH (break-apart) and NGS utilizing a customized panel containing 71 totally different ALK variants. Amongst 71 instances included on this examine, FISH was evaluable in 58 instances. The concordance of ALK IHC with FISH was 75.9% and that with NGS was 84.5%. The sensitivities of FISH and NGS have been 75.6% and 87.5%, respectively. The median progression-free survival of ALK IHC-positive and FISH-negative group was 5.5 months and that of each constructive was 9.97 months. Regardless of intensive analysis and an extended historical past of glucocorticoids being utilized in varied medical areas, they nonetheless generate a problem for customized medication by inflicting resistance or dependence in practically 50% of sufferers handled.
The target of the current examine was to find out the genetic predictors of variable reactions in inflammatory bowel illness sufferers to glucocorticoid remedy. Evaluation of all of the focused DNA sequences for the entire affected person group indicated 121 totally different useful variants. After affiliation analyses of 31 chosen variants, the polymorphism c.1088A>G within the NR3C1 gene was linked with glucocorticoid resistance (p = 0.002), variant c.241+6A>G of the FKBP5 gene with glucocorticoid sensitivity (p = 0.040), and deletion c.306-7delT within the MAPK14 gene with an hostile therapeutic impact (dependency and resistance, p = 0.041) in ulcerative colitis sufferers.

Affiliation of Postoperative Biomarker Response with Recurrence and Survival in Sufferers with Hepatocellular Carcinoma and Excessive Alpha-Fetoprotein Expressions (>400 ng/ml)

Excessive alpha-fetoprotein (AFP) expressions (>400 ng/mL) are related to poor oncological traits for hepatocellular carcinoma (HCC). Nevertheless, prognosis after liver resection for high-AFP HCC is poorly studied. To research long-term recurrence and survival after hepatectomy for high-AFP HCC, and to establish the predictive worth of postoperative incomplete biomarker response (IBR) on general survival (OS) and recurrence-free survival (RFS). In Crohn’s illness, the change c.2685+49T>C of the ABCB1 gene associated to glucocorticoid resistance (p = 0.034).
Sufferers present process healing resection for high-AFP HCC have been analyzed. In line with the decline magnitude of serum AFP as measured at first follow-up (4~6 weeks after surgical procedure), all sufferers have been divided into the whole biomarker response (CBR) and IBR teams. Traits, recurrence, and survival charges have been in contrast. Univariate and Multivariate Cox-regression analyses have been carried out to establish impartial predictors related to poorer OS and RFS after liver resection for high-AFP HCC.
Amongst 549 sufferers, the general and early recurrence charges in sufferers with IBR have been considerably larger than sufferers with CBR. On multivariate evaluation, postoperative IBR was the strongest danger issue with the best hazard ratio in predicting poor OS and RFS.
Postoperative biomarker response of serum AFP can be utilized in predicting recurrence and survival for high-AFP HCC sufferers. As soon as postoperative IBR was recognized at first follow-up, subsequent enhanced recurrence surveillance and accessible remedies towards recurrence ought to actively be thought of. Holocene have been reconstructed. The research on intraspecific gene stream and homoploid hybridization targeted on hybrid swarms Pinus sylvestris/P. mugo and firs.
IHC versus FISH versus NGS to detect ALK gene rearrangement in NSCLC: all questions answered?

18F-fluciclovine PET/CT detection of biochemical recurrent prostate most cancers in sufferers with PSA ranges <2.00 ng/mL

To ascertain the detection price of prostate most cancers recurrence following definitive remedy by 18F-fluciclovine PET/computed tomography (CT) in sufferers with biochemical recurrence (BCR) and prostate-specific antigen (PSA) ranges lower than 2.00 ng/mL. On this retrospective examine, 78 sufferers with a PSA degree of lower than 2.00 ng/mL have been chosen from the 211 sufferers who underwent no less than one 18F-fluciclovine PET/CT scan at our establishment for the detection of biochemical recurrent prostate most cancers between April 2017 and December 2018. Inherent variations within the traits of sufferers with and with out a constructive scan have been investigated for potential associations utilizing multivariable evaluation.
A number of constructive websites of recurrence have been recognized in 44 out of 78 sufferers (56.4%). Sufferers with a Gleason rating between eight and 10 have been extra prone to have a constructive scan in comparison with sufferers with Gleason scores of 6-7 [adjusted odds ratio: 3.53, 95% confidence interval (1.13-10.99), P = 0.03]. No different vital affiliation was discovered between PSA, T classification, and detection price. 18F-fluciclovine PET/CT demonstrated a detection price of 56.4% amongst sufferers with a PSA under 2.Zero ng/mL. The outcomes of this examine assist the usage of 18F-fluciclovine PET/CT for the detection of recurrent prostate most cancers at decrease PSA ranges, even at PSA ranges lower than 0.5 ng/mL
WUV-M20, UV Transilluminator, 312nm, 220V
3532198 1unit
EUR 1627
FBS-HI - Heat Inactivated Fetal Bovine Serum
FBS001-HI 500 ml
EUR 564
uv transilluminator 20x20cm, 312nm, 50/100% switch
UVTR2200 ea
EUR 1161
BLook: LED Transilluminator
BK001 1 pcs Ask for price
transilluminator led 20x12 cm + hood
BLOOK ea
EUR 580
HI TOPK 032
B5640-10 10 mg
EUR 203
HI TOPK 032
B5640-5 5 mg
EUR 137
HI-TOPK-032
HY-101550 100mg
EUR 849
Osteoprotegerin Hi-5 Protein
20-abx263246
  • EUR 1609.00
  • EUR 328.00
  • EUR 230.00
  • 100 ug
  • 10 ug
  • 2 µg
  • Shipped within 5-10 working days.
Fluorescent UV Particles
FP-15040-2 2 mL
EUR 283
Description: Please reffer to the technical data sheet for more detail information for this item. Our dedicated team would be happy to assist you via live chat, email or phone.
UV TRANSMITTING TRAY
GD-GCS 1/pk
EUR 208
Description: Lab Equipment; Axygen Branded EQ
uv protected glasses
VLLP70 ea
EUR 99
SensiFAST Genotyping Hi-Rox Kit
BIO-35005 500 Reactions Ask for price
SensiFAST Genotyping Hi-ROX Mix
BIO-35020 2000 rxns Ask for price
Hi-Fi Reaction Buffer, 5x
BIO-37110 2 x 1.5ml Ask for price
SensiFAST Probe Hi-ROX Kit
BIO-82002/S Sample Ask for price
SensiFAST Probe Hi-ROX Kit
BIO-82005 500 rxns Ask for price
SensiFAST Probe Hi-ROX Kit
BIO-82020 2000 rxns Ask for price
SensiFAST SYBR Hi-ROX Kit
BIO-92002/S Sample Ask for price
SensiFAST SYBR Hi-ROX Kit
BIO-92005 500 rxns Ask for price
SensiFAST SYBR Hi-ROX Kit
BIO-92020 2000 rxns Ask for price
EBV Bam HI-Z Antibody
abx021695-1mg 1 mg
EUR 1156
  • Shipped within 5-10 working days.
Recombinant Human Osteoprotegerin Hi-5
7-01327 2µg Ask for price
Recombinant Human Osteoprotegerin Hi-5
7-01328 10µg Ask for price
Recombinant Human Osteoprotegerin Hi-5
7-01329 100µg Ask for price
Hi-Bind? Protein G-Agarose
6513-1
EUR 234
Hi-Bind? Protein G-Agarose
6513-100
EUR 4557
Hi-Bind? Protein G-Agarose
6513-1000 Ask for price
Hi-Bind? Protein G-Agarose
6513-25
EUR 1762
Hi-Bind? Protein G-Agarose
6513-5
EUR 566
Hi-Bind? Protein A-Agarose
6520-1
EUR 164
Hi-Bind? Protein A-Agarose
6520-100
EUR 3421
Hi-Bind? Protein A-Agarose
6520-1000 Ask for price
Hi-Bind? Protein A-Agarose
6520-25
EUR 1572
Hi-Bind? Protein A-Agarose
6520-5
EUR 495
Hi-Bind? Protein A-Agarose
6520-500
EUR 9783
Hi-Bind? T-Gel-Agarose
M1313-1
EUR 131
Hi-Bind? T-Gel-Agarose
M1313-10
EUR 218
Hi-Bind? T-Gel-Agarose
M1313-100
EUR 1501
SensiMix SYBR Hi-ROX Kit
QT605-05 500 rxn Ask for price
SensiMix SYBR Hi-ROX Kit
QT605-20 2000 rxn Ask for price
SmartDoc UV Blocking Mat
E5000-MAT 1 PC
EUR 100.67
  • To order instruments in 115V / US plug please delete the 'E' off the order code.European 2 pin plugs will be supplied as standard, please request UK if required.
uv lamp 1x15w, 254nm
VL115-C ea
EUR 656
uv lamp 1x15w, 365nm
VL115-L ea
EUR 656
uv lamp 1x15w, 312nm
VL115-M ea
EUR 656
uv lamp 2x15w, 254nm
VL215-C ea
EUR 792
uv lamp 2x15w, 365nm
VL215-L ea
EUR 792
uv lamp 2x15w, 312nm
VL215-M ea
EUR 817
uv lamp 1x6w, 254nm
VL6-C ea
EUR 521
uv lamp 1x6w, 365nm
VL6-L ea
EUR 521
conversion screen uv/blue
VLFC26-BLUE ea
EUR 606
conversion screen uv/wl
VLFC26-WL ea
EUR 606
uv protected face shield
VLMP80 ea
EUR 183
uv protected face shield
VLMP800 ea
EUR 200
nUVaClean UV pipette carousel, with UV lamp, for 6 universal pipettes,
P5590 1/pack
EUR 356.25
Description: nUVaClean UV pipette carousel with UV lamp
nUVaClean UV pipette carousel, with UV lamp, for 6 universal pipettes,
P5590-E 1/pack
EUR 356.25
Description: nUVaClean UV pipette carousel with UV lamp
Hi-Bind? Cibacron Blue-Agarose Beads
7923-10
EUR 153
Hi-Bind? Cibacron Blue-Agarose Beads
7923-50
EUR 403
Hi-Bind? Albumin-IgG Depletion Beads
7933-1
EUR 175
Hi-Bind? Albumin-IgG Depletion Beads
7933-25
EUR 1675
Hi-Bind? Albumin-IgG Depletion Beads
7933-5
EUR 512
MOTOR, DD HI-TORQUE, 220V, CLOCKWISETURNING
402645 1/pk
EUR 1909
Description: Bioprocess Vessels; Spinner Accessories
Hi-Bind? Ni QR Agarose Beads
6562-1
EUR 109
Hi-Bind? Ni QR Agarose Beads
6562-10
EUR 153
Hi-Bind? Ni QR Agarose Beads
6562-100
EUR 707
Hi-Bind? Ni QR Agarose Beads
6562-500
EUR 2654
EpiNext Hi-Fi cDNA Synthesis Kit
P-9004 20 Samples
EUR 318.25
Description: Ask the seller for details
UV Carboxyl Particle Array Kit
UVCPAK--5042-14K 14X1 mL
EUR 1278
Description: UltraRainbow Fluorescent Particlesare calibration particles that help you to determine if a flow cytometer is properly aligned and has a clean flow cell with no fluidic blockage. Using SPHERO? Alignment Particles, the coefficients of variation (CVs), peak channels, and histogram distributions can be measured to determine the alignment and functionality of the flow cytometer.
uv lamp 2x15w, 254/365nm
VL215-LC ea
EUR 817
uv lamp 2x15w, 312/365nm
VL215-LM ea
EUR 817
uv lamp 2x15w, 254/312nm
VL215-MC ea
EUR 859
uv lamp 2x6w, 254/365nm
VL6-LC ea
EUR 538
starter uv tube 4w-20w
VLST151 ea
EUR 56
SensiFAST SYBR Hi-ROX One-Step Kit
BIO-73001 100 rxns Ask for price
SensiFAST SYBR Hi-ROX One-Step Kit
BIO-73005 500 rxns Ask for price
SensiFAST Probe Hi-ROX One-Step Kit
BIO-77001 100 rxns Ask for price
SensiFAST Probe Hi-ROX One-Step Kit
BIO-77005 500 rxns Ask for price
DRIVE SHAFT/CAP ASSEMBLY HI-TORQUE 120MM
4520-9106 1/pk
EUR 845
Description: Bioprocess Vessels; Spinner Accessories
DRIVE SHAFT/CAP ASY,HI TORQUE,120MM
400649 1/pk
EUR 1951
Description: Bioprocess Vessels; Spinner Accessories
DRV SHFT/CAP ASY HI TORQ 100MM
402614 1/pk
EUR 1951
Description: Bioprocess Vessels; Spinner Accessories
uv table 8w 254nm 15x15 cm
VLECX-15C ea
EUR 1028
uv table 8w 312nm 15x15 cm
VLECX-15M ea
EUR 1028
uv table blue led 20x20 cm
VLECX-20BLUE ea
EUR 1535
uv table 8w 254nm 20x20 cm
VLECX-20C ea
EUR 1113
uv table 8w 365nm 20x20 cm
VLECX-20L ea
EUR 1113
uv table 8w 312nm 20x20 cm
VLECX-20M ea
EUR 1163
uv table 8w, 254nm 21x26 cm
VLECX-26C ea
EUR 1197
uv table 8w, 312nm 21x26 cm
VLECX-26M ea
EUR 1248
uv tube 15 w, 254 nm
VLT15-C ea
EUR 56
uv tube 15 w, 365 nm
VLT15-L ea
EUR 56
uv tube 15 w, 312 nm
VLT15-M ea
EUR 82
uv tube 4 w, 254 nm
VLT4-C ea
EUR 56
uv tube 4 w, 365 nm
VLT4-L ea
EUR 56
uv tube 6 w, 254 nm
VLT6-C ea
EUR 56
uv tube 6 w, 365 nm
VLT6-L ea
EUR 56
uv tube 8 w, 254 nm
VLT8-C ea
EUR 56
uv tube 8 w, 365 nm
VLT8-L ea
EUR 56
uv tube 8 w, 312 nm
VLT8-M ea
EUR 82
Absolute Mag Magnetic Particles, Fluorescent UV
WHM-S135 2 mL
EUR 604
OPG Human, Osteoprotegerin Human Recombinant Protein, Hi-5
PROTO00300-3 Regular: 10ug
EUR 317
Description: Recombinant Osteoprotegerin produced in baculovirus is a signle, glycosylated polypeptide chain containing 398 amino acid residues (22-401 a.a.), having a calculated molecular mass of 45.6 kDa. The Osteoprotegerin is fused to a 17 amino acid His tag at C-terminus and purified by proprietary chromatographic techniques.
Uv Radiation Resistance Associated Gene (UVRAG) Antibody
20-abx116558
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.
PLT,96WL,UV,NT,NS,25/50
3635 25/pk
EUR 545
Description: Genomics; Genomic Plates
WSE-5300 Printgraph CMOS I 6M UV
2305300 1unit
EUR 8510
Description: I ncl udes 312 nm U V t r ansi l l umi nat or , Whi t e L EDl i ght pl at e CE marked
Bacillus cereus UV DNA damage endonuclease (uvsE)
1-CSB-EP467668BQP
  • EUR 611.00
  • EUR 309.00
  • EUR 1827.00
  • EUR 939.00
  • EUR 1218.00
  • EUR 397.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 44.0 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Bacillus cereus UV DNA damage endonuclease(uvsE) expressed in E.coli
uv table 8w 365/254nm 20x20 cm
VLTCP-20LC ea
EUR 1282
uv table 8w 365/312nm 20x20 cm
VLTCP-20LM ea
EUR 1282
uv table 8w 312/254nm 20x20 cm
VLTCP-20MC ea
EUR 1282
uv table 2x8w, 365/254nm 21x26 cm
VLTCP-26LC ea
EUR 1620
uv table 2x8w, 365/312nm 21x26 cm
VLTCP-26LM ea
EUR 1620
uv table 2x8w, 312/254nm 21x26 cm
VLTCP-26MC ea
EUR 1620
Standard UV Quartz Cell with Teflon Stopper
SQ014 1 UNIT
EUR 147.24
  • Product category: Labware/Cuvettes/Quartz Cells
AzuraView GreenFast qPCR Blue Mix Hi Rox - 200 Rxn
AZ-2401 200 Rxn
EUR 179
AzuraView GreenFast qPCR Blue Mix Hi Rox - 500 Rxn
AZ-2405 500 Rxn
EUR 320
AzuraView GreenFast qPCR Blue Mix Hi Rox - 2000 Rxn
AZ-2420 2000 Rxn
EUR 996
AzuraView GreenFast qPCR Blue Mix Hi Rox - 5000 Rxn
AZ-2421 5000 Rxn
EUR 2348
Heat Shock 70 kDa protein 5, Hi-5 Protein
20-abx260789
  • EUR 3418.00
  • EUR 328.00
  • EUR 230.00
  • 1 mg
  • 20 ug
  • 5 ug
  • Shipped within 5-10 working days.
Recombinant Human Heat Shock 70kDa protein 5, Hi-5
7-07003 5µg Ask for price
Recombinant Human Heat Shock 70kDa protein 5, Hi-5
7-07004 20µg Ask for price
Recombinant Human Heat Shock 70kDa protein 5, Hi-5
7-07005 1mg Ask for price
UV excision repair protein RAD23 homolog A Antibody
20-abx110497
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
UV Radiation Resistance-Associated Gene Protein (UVRAG) Antibody
20-abx006162
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.
UV Radiation Resistance-Associated Gene Protein (UVRAG) Antibody
abx030355-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.
UV Radiation Resistance-Associated Gene Protein (UVRAG) Antibody
abx030355-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.
UV Radiation Resistance-Associated Gene Protein (UVRAG) Antibody
abx030356-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.
UV Radiation Resistance-Associated Gene Protein (UVRAG) Antibody
abx030356-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.
UV Radiation Resistance-Associated Gene Protein (UVRAG) Antibody
abx030357-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.
UV Radiation Resistance-Associated Gene Protein (UVRAG) Antibody
abx030357-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.
UV Radiation Resistance-Associated Gene Protein (UVRAG) Antibody
abx030358-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.
UV Radiation Resistance-Associated Gene Protein (UVRAG) Antibody
abx030358-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.
UV Radiation Resistance-Associated Gene Protein (UVRAG) Antibody
20-abx313923
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
UV Radiation Resistance-Associated Gene Protein (UVRAG) Antibody
abx448488-100ug 100 ug
EUR 523
  • Shipped within 5-12 working days.
UV Radiation Resistance-Associated Gene Protein (UVRAG) Antibody
abx448489-100ug 100 ug
EUR 523
  • Shipped within 5-12 working days.
UV Radiation Resistance-Associated Gene Protein (UVRAG) Antibody
abx239352-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.
One-Step Lumitein UV Protein Gel Stain, 1X
21005-1L 1L
EUR 222
Description: Minimum order quantity: 1 unit of 1L
One-Step Lumitein UV Protein Gel Stain, 1X
21005-4L 4L
EUR 567
Description: Minimum order quantity: 1 unit of 4L
One-Step Lumitein UV Protein Gel Stain, 1X
21005-F 25mL
EUR 50
Description: Minimum order quantity: 1 unit of 25mL
uv table 8w 254nm/wl 2x(20x20) cm
VLTFP-CWL ea
EUR 1535
uv table 8w 365nm/wl 2x(20x20) cm
VLTFP-LWL ea
EUR 1535
uv table 8w 312nm/wl 2x(20x20) cm
VLTFP-MWL ea
EUR 1535
Replacement power supply for nUVaClean UV Pipette Carousel
P5590-PS 1/pack
EUR 76.33
Description: Replacement power supply for nUVaClean UV Pipette Carousel
BioWand Personal UV Sanitizer, 265-280nm, 1/ea
U1001-W 1/pack
EUR 96.58
Description: BioWand Personal UV Sanitizer 265-280nm
High-Mobility Group Box 1 Hi-5 Insect Cells Protein
20-abx261998
  • EUR 4490.00
  • EUR 328.00
  • EUR 230.00
  • 1 mg
  • 20 ug
  • 5 ug
  • Shipped within 5-10 working days.
DKK1 Hi-5 Dickkopf-Related Protein 1 Human Recombinant Protein
PROTO94907 Regular: 5ug
EUR 471
Description: DKK1 produced in Hi-5 is a single, glycosylated polypeptide chain containing 253 amino acids (32-266 a.a.) and having a molecular mass of 27.8 kDa (Molecular size on DSD-PAGE will appear at approximately 40kDa).;DKK1 is expressed with a 15 amino acid His tag at C-Terminus and purified by proprietary chromatographic techniques.
Recombinant Human High-Mobility Group Box 1 Hi-5 Insect Cells
7-05356 5µg Ask for price
Recombinant Human High-Mobility Group Box 1 Hi-5 Insect Cells
7-05357 20µg Ask for price
Recombinant Human High-Mobility Group Box 1 Hi-5 Insect Cells
7-05358 1mg Ask for price
UV excision repair protein RAD23 homolog A Antibody (HRP)
20-abx109043
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
UV Excision Repair Protein RAD23 Homolog B (RAD23B) Antibody
abx159674-100ul 100 ul
EUR 467
  • Shipped within 5-10 working days.
UV excision repair protein RAD23 homolog A Antibody (Biotin)
20-abx106211
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
UV excision repair protein RAD23 homolog A Antibody (FITC)
20-abx107625
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
UV Radiation Resistance-Associated Gene Protein (UVRAG) Antibody (HRP)
20-abx313924
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
UV Radiation Resistance-Associated Gene Protein (UVRAG) Antibody (FITC)
20-abx313925
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
UV Radiation Resistance-Associated Gene Protein (UVRAG) Antibody (Biotin)
20-abx313926
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
UV Excision Repair Protein RAD23 Homolog A (RAD23A) Antibody
abx224223-100ug 100 ug
EUR 411
  • Shipped within 5-10 working days.
UV Radiation Resistance-Associated Gene Protein (UVRAG) Antibody (ALP)
abx446398-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.
UV Radiation Resistance-Associated Gene Protein (UVRAG) Antibody (ALP)
abx446399-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.
UV Radiation Resistance-Associated Gene Protein (UVRAG) Antibody (APC)
abx446400-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.
UV Radiation Resistance-Associated Gene Protein (UVRAG) Antibody (APC)
abx446401-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.
UV Radiation Resistance-Associated Gene Protein (UVRAG) Antibody (Biotin)
abx446402-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.
UV Radiation Resistance-Associated Gene Protein (UVRAG) Antibody (Biotin)
abx446403-100ug 100 ug
EUR 578
  • Shipped within 5-12 working days.
UV Radiation Resistance-Associated Gene Protein (UVRAG) Antibody (FITC)
abx446404-100ug 100 ug
EUR 565
  • Shipped within 5-12 working days.
UV Radiation Resistance-Associated Gene Protein (UVRAG) Antibody (FITC)
abx446405-100ug 100 ug
EUR 565
  • Shipped within 5-12 working days.
This overview summarizes the event of inhabitants genetics and inhabitants genomics research of forest bushes in Slovakia in the course of the previous 40 years. Varied protein and DNA markers have been utilized throughout this era to handle a number of subjects in evolutionary genetics and biogeography of bushes: allozymes, uniparentally inherited chloroplast and mitochondrial markers, easy sequence repeats and single nucleotide polymorphisms. The primary object of research of phylogeny and postglacial migration have been Fagus sylvatica s.l. and eastern-Mediterranean firs (Abies Mill. part Abies), the place the divergence of genetic lineages (species and subspecific taxa) in time, in addition to colonization of the present ranges in the course of the